1. spacer 1.54|1361164|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 3, identity: 0.906
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
gagctgggcgaactggacggcactttccgcaa Protospacer
**..******************* ********
2. spacer 1.128|1361165|32|NZ_CP007030|PILER-CR matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 3, identity: 0.906
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
gagctgggcgaactggacggcactttccgcaa Protospacer
**..******************* ********
3. spacer 1.1|1357981|32|NZ_CP007030|CRISPRCasFinder,CRT matches to AP014423 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S46-C189, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 4, identity: 0.875
--ccagcacgggtgaaacaaaagttgtagctgat CRISPR spacer
tatcagca--ggtgaatcaaaagttgtagctgat Protospacer
.***** ****** *****************
4. spacer 1.1|1357981|32|NZ_CP007030|CRISPRCasFinder,CRT matches to AP014417 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C24-MedDCM-OCT-S39-C59, *** SEQUENCING IN PROGRESS ***, 5 ordered pieces) position: , mismatch: 4, identity: 0.875
--ccagcacgggtgaaacaaaagttgtagctgat CRISPR spacer
catcagca--ggtgaatcaaaagttgtagctgat Protospacer
.***** ****** *****************
5. spacer 1.34|1359962|33|NZ_CP007030|CRISPRCasFinder,CRT matches to LT992259 (Yersinia phage fEV-1 genome assembly, complete genome: monopartite) position: , mismatch: 4, identity: 0.879
acgtaacgctgtaaacaacacgcctgaatacat CRISPR spacer
gcgtaacgcagtgaacaacacgcctgaatacag Protospacer
.******** **.*******************
6. spacer 1.108|1359963|33|NZ_CP007030|PILER-CR matches to LT992259 (Yersinia phage fEV-1 genome assembly, complete genome: monopartite) position: , mismatch: 4, identity: 0.879
acgtaacgctgtaaacaacacgcctgaatacat CRISPR spacer
gcgtaacgcagtgaacaacacgcctgaatacag Protospacer
.******** **.*******************
7. spacer 1.54|1361164|32|NZ_CP007030|CRISPRCasFinder,CRT matches to CP054330 (Escherichia coli strain SCU-121 plasmid pSCU-121-2, complete sequence) position: , mismatch: 5, identity: 0.844
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
gagcttggcgaactggacaccacattccgcaa Protospacer
**..* ************. ************
8. spacer 1.128|1361165|32|NZ_CP007030|PILER-CR matches to CP054330 (Escherichia coli strain SCU-121 plasmid pSCU-121-2, complete sequence) position: , mismatch: 5, identity: 0.844
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
gagcttggcgaactggacaccacattccgcaa Protospacer
**..* ************. ************
9. spacer 1.23|1359302|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KC462197 (Burkholderia phage ST79, complete genome) position: , mismatch: 6, identity: 0.812
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcctgcgtacagttattgacacgagtccaa Protospacer
. *** ***********************
10. spacer 1.27|1359542|32|NZ_CP007030|CRISPRCasFinder,CRT matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 6, identity: 0.812
agcaaggccgagaaaaaagcgggtga-gtatca CRISPR spacer
gccaaggccgagaaaaaagcggatgacgcatt- Protospacer
. ********************.*** *.**.
11. spacer 1.62|1361646|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 6, identity: 0.812
agctttggctttgagcaaggcga-agccgcgca CRISPR spacer
agctttggcgttgagcaatgcgacctctgcgc- Protospacer
********* ******** **** *.****
12. spacer 1.97|1359303|32|NZ_CP007030|PILER-CR matches to KC462197 (Burkholderia phage ST79, complete genome) position: , mismatch: 6, identity: 0.812
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcctgcgtacagttattgacacgagtccaa Protospacer
. *** ***********************
13. spacer 1.101|1359543|32|NZ_CP007030|PILER-CR matches to CP000876 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU01, complete sequence) position: , mismatch: 6, identity: 0.812
agcaaggccgagaaaaaagcgggtga-gtatca CRISPR spacer
gccaaggccgagaaaaaagcggatgacgcatt- Protospacer
. ********************.*** *.**.
14. spacer 1.136|1361647|32|NZ_CP007030|PILER-CR matches to NZ_CP010861 (Marinovum algicola DG 898 plasmid pMaD6, complete sequence) position: , mismatch: 6, identity: 0.812
agctttggctttgagcaaggcga-agccgcgca CRISPR spacer
agctttggcgttgagcaatgcgacctctgcgc- Protospacer
********* ******** **** *.****
15. spacer 1.3|1358101|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 7, identity: 0.781
taggtgatatcaatgaggctgttcacagagat CRISPR spacer
taggtgatatcaatgtggctcttgatgcagtt Protospacer
*************** **** ** *.. ** *
16. spacer 1.12|1358641|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT024872 (Streptomyces phage Muntaha, complete genome) position: , mismatch: 7, identity: 0.781
ctgggggcggttgccttgcctcacgttgacca CRISPR spacer
catgcggcggttgccctggctcacgttgaaaa Protospacer
* * **********.** ********** *
17. spacer 1.12|1358641|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT024865 (Streptomyces phage Wakanda, complete genome) position: , mismatch: 7, identity: 0.781
ctgggggcggttgccttgcctcacgttgacca CRISPR spacer
catgcggcggttgccctggctcacgttgaaaa Protospacer
* * **********.** ********** *
18. spacer 1.23|1359302|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MH986725 (Pseudoalteromonas phage DW, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
ctggaaccgtacagttattgacacgagtccaa Protospacer
.**. ***********************
19. spacer 1.23|1359302|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_009236 (Burkholderia phage phiE12-2 chromosome, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcccgcgtacagttattgacacgagtccaa Protospacer
. *.* ***********************
20. spacer 1.23|1359302|32|NZ_CP007030|CRISPRCasFinder,CRT matches to CP000624 (Burkholderia phage phiE12-2, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcccgcgtacagttattgacacgagtccaa Protospacer
. *.* ***********************
21. spacer 1.46|1360684|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 7, identity: 0.781
ggccaatcagtcagcggatcggctcaaatgat CRISPR spacer
ggccaatcactcaccggatcggctcacggcac Protospacer
********* *** ************ . *.
22. spacer 1.50|1360924|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_LR134435 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 26) position: , mismatch: 7, identity: 0.781
ctcaagggttttatttcagcggattatgacga CRISPR spacer
atcaagggttttacttcagctgattatttata Protospacer
************.****** ****** *
23. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.781
----attgcctcaaacattttgagcggcttcaacat CRISPR spacer
atgcatagc----aacatttttagcagcttcaacat Protospacer
** ** ******** ***.**********
24. spacer 1.77|1358102|32|NZ_CP007030|PILER-CR matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 7, identity: 0.781
taggtgatatcaatgaggctgttcacagagat CRISPR spacer
taggtgatatcaatgtggctcttgatgcagtt Protospacer
*************** **** ** *.. ** *
25. spacer 1.86|1358642|32|NZ_CP007030|PILER-CR matches to MT024872 (Streptomyces phage Muntaha, complete genome) position: , mismatch: 7, identity: 0.781
ctgggggcggttgccttgcctcacgttgacca CRISPR spacer
catgcggcggttgccctggctcacgttgaaaa Protospacer
* * **********.** ********** *
26. spacer 1.86|1358642|32|NZ_CP007030|PILER-CR matches to MT024865 (Streptomyces phage Wakanda, complete genome) position: , mismatch: 7, identity: 0.781
ctgggggcggttgccttgcctcacgttgacca CRISPR spacer
catgcggcggttgccctggctcacgttgaaaa Protospacer
* * **********.** ********** *
27. spacer 1.97|1359303|32|NZ_CP007030|PILER-CR matches to MH986725 (Pseudoalteromonas phage DW, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
ctggaaccgtacagttattgacacgagtccaa Protospacer
.**. ***********************
28. spacer 1.97|1359303|32|NZ_CP007030|PILER-CR matches to NC_009236 (Burkholderia phage phiE12-2 chromosome, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcccgcgtacagttattgacacgagtccaa Protospacer
. *.* ***********************
29. spacer 1.97|1359303|32|NZ_CP007030|PILER-CR matches to CP000624 (Burkholderia phage phiE12-2, complete genome) position: , mismatch: 7, identity: 0.781
ttgactggttacagttattgacacgagtccaa CRISPR spacer
cgtcccgcgtacagttattgacacgagtccaa Protospacer
. *.* ***********************
30. spacer 1.120|1360685|32|NZ_CP007030|PILER-CR matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 7, identity: 0.781
ggccaatcagtcagcggatcggctcaaatgat CRISPR spacer
ggccaatcactcaccggatcggctcacggcac Protospacer
********* *** ************ . *.
31. spacer 1.124|1360925|32|NZ_CP007030|PILER-CR matches to NZ_LR134435 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 26) position: , mismatch: 7, identity: 0.781
ctcaagggttttatttcagcggattatgacga CRISPR spacer
atcaagggttttacttcagctgattatttata Protospacer
************.****** ****** *
32. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 7, identity: 0.781
----attgcctcaaacattttgagcggcttcaacat CRISPR spacer
atgcatagc----aacatttttagcagcttcaacat Protospacer
** ** ******** ***.**********
33. spacer 1.1|1357981|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN694153 (Marine virus AFVG_250M457, complete genome) position: , mismatch: 8, identity: 0.75
ccagcacgggtgaaacaaaagttgtagctgat CRISPR spacer
ctaaggctagtgaaacaaaaattgtagatgat Protospacer
*.*. .* .***********.****** ****
34. spacer 1.7|1358341|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cctctccttgacgactttagcggccgcctcat Protospacer
..** ..***.**** ************** *
35. spacer 1.33|1359902|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693431 (Marine virus AFVG_25M363, complete genome) position: , mismatch: 8, identity: 0.75
ttatctagtaaagctaaactgtataactctgc CRISPR spacer
gtatctagtaaatttaaactgtattcattagc Protospacer
*********** .********** *. **
36. spacer 1.39|1360264|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 8, identity: 0.75
atctaaaatgagtttttgtgcctgggcgactt CRISPR spacer
cccggaaatgagtttttgcgcctgggcgtcca Protospacer
.* .*************.********* *.
37. spacer 1.39|1360264|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atctaaaatgagtttttgtgcctgggcgactt CRISPR spacer
atcggggatgagtttatgtgccagggcgaccg Protospacer
*** ...******** ****** *******.
38. spacer 1.41|1360384|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgttatcgtttgccgcccggctgccctt CRISPR spacer
cggacgcagtcgtctgccgcccggctgccttt Protospacer
* .**. .****.***************.**
39. spacer 1.51|1360984|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693940 (Marine virus AFVG_250M588, complete genome) position: , mismatch: 8, identity: 0.75
taaatgcacagtaccaagacccaagtttttta CRISPR spacer
tgtttgtgaagtaccaagtgccaagtttttta Protospacer
*. **.. ********* ************
40. spacer 1.54|1361164|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.75
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
caggcgcgcgaactggacgacaccttccgcca Protospacer
*. .* ************.*** ****** *
41. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to CP016947 (Yersinia enterocolitica strain YE1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
42. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP016938 (Yersinia enterocolitica strain YE6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
43. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP016934 (Yersinia enterocolitica strain YE7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
44. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP016942 (Yersinia enterocolitica strain YE3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
45. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP016941 (Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
46. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP016932 (Yersinia enterocolitica strain YE165 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
47. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP025801 (Yersinia ruckeri strain SC09 plasmid pWKY, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
48. spacer 1.55|1361224|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MK448659 (Streptococcus satellite phage Javan89, complete genome) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttttttccaagcattttgagcagcttcaactt Protospacer
** ...***.**********.******** *
49. spacer 1.62|1361646|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
agctttggctttgagcaaggcgaagccgcgca CRISPR spacer
ccctgccgctttgagcaaggtcaagccgcgcc Protospacer
** . *************. *********
50. spacer 1.81|1358342|32|NZ_CP007030|PILER-CR matches to NZ_CP017943 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cctctccttgacgactttagcggccgcctcat Protospacer
..** ..***.**** ************** *
51. spacer 1.107|1359903|32|NZ_CP007030|PILER-CR matches to MN693431 (Marine virus AFVG_25M363, complete genome) position: , mismatch: 8, identity: 0.75
ttatctagtaaagctaaactgtataactctgc CRISPR spacer
gtatctagtaaatttaaactgtattcattagc Protospacer
*********** .********** *. **
52. spacer 1.113|1360265|32|NZ_CP007030|PILER-CR matches to NZ_CP044989 (Deinococcus sp. AJ005 plasmid p380k, complete sequence) position: , mismatch: 8, identity: 0.75
atctaaaatgagtttttgtgcctgggcgactt CRISPR spacer
cccggaaatgagtttttgcgcctgggcgtcca Protospacer
.* .*************.********* *.
53. spacer 1.113|1360265|32|NZ_CP007030|PILER-CR matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
atctaaaatgagtttttgtgcctgggcgactt CRISPR spacer
atcggggatgagtttatgtgccagggcgaccg Protospacer
*** ...******** ****** *******.
54. spacer 1.115|1360385|32|NZ_CP007030|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcgttatcgtttgccgcccggctgccctt CRISPR spacer
cggacgcagtcgtctgccgcccggctgccttt Protospacer
* .**. .****.***************.**
55. spacer 1.125|1360985|32|NZ_CP007030|PILER-CR matches to MN693940 (Marine virus AFVG_250M588, complete genome) position: , mismatch: 8, identity: 0.75
taaatgcacagtaccaagacccaagtttttta CRISPR spacer
tgtttgtgaagtaccaagtgccaagtttttta Protospacer
*. **.. ********* ************
56. spacer 1.128|1361165|32|NZ_CP007030|PILER-CR matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 8, identity: 0.75
gaattgggcgaactggacggcacattccgcaa CRISPR spacer
caggcgcgcgaactggacgacaccttccgcca Protospacer
*. .* ************.*** ****** *
57. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to CP016947 (Yersinia enterocolitica strain YE1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
58. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP016938 (Yersinia enterocolitica strain YE6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
59. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP016934 (Yersinia enterocolitica strain YE7 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
60. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP016942 (Yersinia enterocolitica strain YE3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
61. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP016941 (Yersinia enterocolitica strain YE5 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
62. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP016932 (Yersinia enterocolitica strain YE165 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
63. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to NZ_CP025801 (Yersinia ruckeri strain SC09 plasmid pWKY, complete sequence) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttgaccgataacattttgtgaggcttcaacat Protospacer
* .** ********* * ***********
64. spacer 1.129|1361225|32|NZ_CP007030|PILER-CR matches to MK448659 (Streptococcus satellite phage Javan89, complete genome) position: , mismatch: 8, identity: 0.75
attgcctcaaacattttgagcggcttcaacat CRISPR spacer
ttttttccaagcattttgagcagcttcaactt Protospacer
** ...***.**********.******** *
65. spacer 1.136|1361647|32|NZ_CP007030|PILER-CR matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
agctttggctttgagcaaggcgaagccgcgca CRISPR spacer
ccctgccgctttgagcaaggtcaagccgcgcc Protospacer
** . *************. *********
66. spacer 1.1|1357981|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_019509 (Cronobacter phage ESP2949-1, complete genome) position: , mismatch: 9, identity: 0.719
ccagcacgggtgaaacaaaagttgtagctgat CRISPR spacer
ccagcatgggtgaaacagaagttcaggcaaga Protospacer
******.**********.***** .** ..
67. spacer 1.1|1357981|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN694437 (Marine virus AFVG_250M820, complete genome) position: , mismatch: 9, identity: 0.719
ccagcacgggtgaaacaaaagttgtagctgat CRISPR spacer
ctccttcggctgaaacaaaatttgtagcttct Protospacer
*. . *** ********** ******** *
68. spacer 1.5|1358221|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719
aaattcgctatctcttgcagccgtccacacaa CRISPR spacer
cccgtttttatctcttgcagccatccacacag Protospacer
*. .**************.********.
69. spacer 1.7|1358341|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 9, identity: 0.719
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cggcaggttggcgacggcagcggccgcctcga Protospacer
. ** ********* .************
70. spacer 1.7|1358341|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cggcaggttggcgacggcagcggccgcctcga Protospacer
. ** ********* .************
71. spacer 1.9|1358461|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcttttcagccaaggccgaagacgtgacc Protospacer
*.************** ******** ..
72. spacer 1.9|1358461|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcctttcagccaaggccgaagacgttacc Protospacer
*.*.************ ********* ..
73. spacer 1.9|1358461|32|NZ_CP007030|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcctttcagccaaggccgaagacgttacc Protospacer
*.*.************ ********* ..
74. spacer 1.13|1358701|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 9, identity: 0.719
atgtggtggaaatcggtttgaacggctttcaa CRISPR spacer
agcttcgcgaactcggtttcaacggctttcac Protospacer
* * *** ******* ***********
75. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP015858 (Lactobacillus plantarum strain LZ227 plasmid LZ227p1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
76. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
77. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
78. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
79. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
80. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
81. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035021 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pA) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
82. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035114 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
83. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
84. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP012657 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
85. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017955 (Lactobacillus plantarum strain C410L1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
86. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
87. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
88. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
89. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
90. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
91. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
92. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
93. spacer 1.17|1358942|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
94. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP015858 (Lactobacillus plantarum strain LZ227 plasmid LZ227p1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
95. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
96. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
97. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
98. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
99. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
100. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035021 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pA) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
101. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP035114 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
102. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
103. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP012657 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
104. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017955 (Lactobacillus plantarum strain C410L1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
105. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
106. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
107. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
108. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
109. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
110. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
111. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
112. spacer 1.18|1359002|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
113. spacer 1.23|1359302|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KM236245 (Bacillus phage Mater, complete genome) position: , mismatch: 9, identity: 0.719
ttgactggttacagttattgacacgagtccaa CRISPR spacer
taaactggttacagatattgaaacgatcatta Protospacer
* .*********** ****** **** . . *
114. spacer 1.28|1359602|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 9, identity: 0.719
tccggccgagccaaaacgcccaggccagcgat CRISPR spacer
aaggcgagagcccaaacgccgaggccagcgaa Protospacer
* ***** ******* **********
115. spacer 1.29|1359662|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
attgcgtggcgttgcagttgctcatgctgtta CRISPR spacer
attgctcggcgttgcagttgctcgaacacgca Protospacer
***** .****************. .* .*
116. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP014570 (Campylobacter fetus subsp. venerealis strain 01/165 plasmid mp2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
ttagaaatagctcaaaaatggatagacaaaaa Protospacer
.. **** ************** ***. * *
117. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871446 (UNVERIFIED: Serratia phage KpLz-2_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
118. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871452 (UNVERIFIED: Serratia phage KpZh_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
119. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871447 (UNVERIFIED: Serratia phage KpLz_1_41, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
120. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871449 (UNVERIFIED: Serratia phage KpXa_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
121. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871453 (UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
122. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871451 (UNVERIFIED: Serratia phage KpYy_2_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
123. spacer 1.45|1360624|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN871448 (UNVERIFIED: Serratia phage KpSz_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
124. spacer 1.48|1360804|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gcatgatccgacgcaagccggaattggcgcaa Protospacer
. * *********** ****** **** *
125. spacer 1.48|1360804|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gcatgatccgacgcaagccggaattggcgcaa Protospacer
. * *********** ****** **** *
126. spacer 1.51|1360984|32|NZ_CP007030|CRISPRCasFinder,CRT matches to LR877331 (Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719
taaatgcacagtaccaagacccaagtttttta CRISPR spacer
aacggccgcagtaccaagacctaagttatttc Protospacer
* . *.*************.***** ***
127. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
128. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
129. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP010580 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB76, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
attttcttcatgttttacgatctcaaattgtt Protospacer
** .**** *************** ** .
130. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
131. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
132. spacer 1.52|1361044|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
133. spacer 1.65|1361826|32|NZ_CP007030|CRISPRCasFinder,CRT matches to LR721753 (Aliivibrio wodanis 06/09/160 plasmid 2 complete sequence) position: , mismatch: 9, identity: 0.719
agttgatcggattgccgatggtcgaatttgat CRISPR spacer
atcaatttagattgccgatggtagaagttgat Protospacer
* . . *..************* *** *****
134. spacer 1.70|1362127|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
------gcatattatcattcgctggcggtttttccgct CRISPR spacer
ccggtggcg------catttgctggcggttttgccgct Protospacer
**. ****.************ *****
135. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693179 (Marine virus AFVG_25M461, complete genome) position: , mismatch: 9, identity: 0.719
ttttgattttccattgtttcggtttccttact CRISPR spacer
agggaattttccattttttcggtttacttctt Protospacer
.********** ********* *** .*
136. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KC131021 (Marine gokushovirus isolate GOM, complete genome) position: , mismatch: 9, identity: 0.719
ttttgattttccattgtttcggtttccttact CRISPR spacer
aattgattttccattgttacgtttttttaaac Protospacer
**************** ** ***..* * .
137. spacer 1.79|1358222|32|NZ_CP007030|PILER-CR matches to NZ_CP013139 (Pseudoalteromonas sp. Bsw20308 plasmid pPBSW1, complete sequence) position: , mismatch: 9, identity: 0.719
aaattcgctatctcttgcagccgtccacacaa CRISPR spacer
cccgtttttatctcttgcagccatccacacag Protospacer
*. .**************.********.
138. spacer 1.81|1358342|32|NZ_CP007030|PILER-CR matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 9, identity: 0.719
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cggcaggttggcgacggcagcggccgcctcga Protospacer
. ** ********* .************
139. spacer 1.81|1358342|32|NZ_CP007030|PILER-CR matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tttcattttggcgacgttagcggccgcctcct CRISPR spacer
cggcaggttggcgacggcagcggccgcctcga Protospacer
. ** ********* .************
140. spacer 1.83|1358462|32|NZ_CP007030|PILER-CR matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcttttcagccaaggccgaagacgtgacc Protospacer
*.************** ******** ..
141. spacer 1.83|1358462|32|NZ_CP007030|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcctttcagccaaggccgaagacgttacc Protospacer
*.*.************ ********* ..
142. spacer 1.83|1358462|32|NZ_CP007030|PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719
aagacttttcagccaagggagaagacgttttt CRISPR spacer
tcggcctttcagccaaggccgaagacgttacc Protospacer
*.*.************ ********* ..
143. spacer 1.87|1358702|32|NZ_CP007030|PILER-CR matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 9, identity: 0.719
atgtggtggaaatcggtttgaacggctttcaa CRISPR spacer
agcttcgcgaactcggtttcaacggctttcac Protospacer
* * *** ******* ***********
144. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP015858 (Lactobacillus plantarum strain LZ227 plasmid LZ227p1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
145. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
146. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
147. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
148. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
149. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
150. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP035021 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pA) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
151. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP035114 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
152. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
153. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP012657 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
154. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP017955 (Lactobacillus plantarum strain C410L1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
155. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
156. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
157. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
158. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
159. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
160. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
161. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
162. spacer 1.91|1358943|32|NZ_CP007030|PILER-CR matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
163. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP015858 (Lactobacillus plantarum strain LZ227 plasmid LZ227p1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
164. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP035175 (Lactobacillus plantarum strain SRCM103426 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
165. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP013755 (Lactobacillus plantarum strain DF plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
166. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP035135 (Lactobacillus plantarum strain SRCM103311 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
167. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
168. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
169. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP035021 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pA) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
170. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP035114 (Lactobacillus plantarum strain SRCM103295 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
171. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP013751 (Lactobacillus plantarum strain KP plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtcttttgtcg Protospacer
*********** *********.**. *
172. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP012657 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK01, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
173. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP017955 (Lactobacillus plantarum strain C410L1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
174. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
175. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
176. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
177. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP025417 (Lactobacillus plantarum strain X7021 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
178. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NC_021519 (Lactobacillus plantarum 16 plasmid Lp16H, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
179. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
180. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP046662 (Lactobacillus plantarum strain 83-18 plasmid p83-18.2, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
181. spacer 1.92|1359003|32|NZ_CP007030|PILER-CR matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cttttcatcaatcccttggccgttttcgtgct CRISPR spacer
aatttcatcaatcgcttggccgtctttcgtcg Protospacer
*********** *********.**. *
182. spacer 1.97|1359303|32|NZ_CP007030|PILER-CR matches to KM236245 (Bacillus phage Mater, complete genome) position: , mismatch: 9, identity: 0.719
ttgactggttacagttattgacacgagtccaa CRISPR spacer
taaactggttacagatattgaaacgatcatta Protospacer
* .*********** ****** **** . . *
183. spacer 1.102|1359603|32|NZ_CP007030|PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 9, identity: 0.719
tccggccgagccaaaacgcccaggccagcgat CRISPR spacer
aaggcgagagcccaaacgccgaggccagcgaa Protospacer
* ***** ******* **********
184. spacer 1.103|1359663|32|NZ_CP007030|PILER-CR matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
attgcgtggcgttgcagttgctcatgctgtta CRISPR spacer
attgctcggcgttgcagttgctcgaacacgca Protospacer
***** .****************. .* .*
185. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to NZ_CP014570 (Campylobacter fetus subsp. venerealis strain 01/165 plasmid mp2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
ttagaaatagctcaaaaatggatagacaaaaa Protospacer
.. **** ************** ***. * *
186. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871446 (UNVERIFIED: Serratia phage KpLz-2_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
187. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871452 (UNVERIFIED: Serratia phage KpZh_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
188. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871447 (UNVERIFIED: Serratia phage KpLz_1_41, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
189. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871449 (UNVERIFIED: Serratia phage KpXa_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
190. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871453 (UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
191. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871451 (UNVERIFIED: Serratia phage KpYy_2_45, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
192. spacer 1.119|1360625|32|NZ_CP007030|PILER-CR matches to MN871448 (UNVERIFIED: Serratia phage KpSz_1, complete genome) position: , mismatch: 9, identity: 0.719
gcgcaaatcgctcaaaaatggattgacgcaca CRISPR spacer
atggcggtcgctgaaaaatggattaacgcaga Protospacer
..* ..***** ***********.***** *
193. spacer 1.122|1360805|32|NZ_CP007030|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gcatgatccgacgcaagccggaattggcgcaa Protospacer
. * *********** ****** **** *
194. spacer 1.122|1360805|32|NZ_CP007030|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gcatgatccgacgcaagccggaattggcgcaa Protospacer
. * *********** ****** **** *
195. spacer 1.125|1360985|32|NZ_CP007030|PILER-CR matches to LR877331 (Klebsiella phage vB_KpnM_311F genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719
taaatgcacagtaccaagacccaagtttttta CRISPR spacer
aacggccgcagtaccaagacctaagttatttc Protospacer
* . *.*************.***** ***
196. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
197. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
198. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP010580 (Bacillus thuringiensis serovar morrisoni strain BGSC 4AA1 plasmid pBMB76, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
attttcttcatgttttacgatctcaaattgtt Protospacer
** .**** *************** ** .
199. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
200. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
201. spacer 1.126|1361045|32|NZ_CP007030|PILER-CR matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 9, identity: 0.719
cttagtttcaagttttacgatctcaattttca CRISPR spacer
agtcgtttcaagttttgcaatctcaatgattt Protospacer
* ************.*.******** *.
202. spacer 1.139|1361827|32|NZ_CP007030|PILER-CR matches to LR721753 (Aliivibrio wodanis 06/09/160 plasmid 2 complete sequence) position: , mismatch: 9, identity: 0.719
agttgatcggattgccgatggtcgaatttgat CRISPR spacer
atcaatttagattgccgatggtagaagttgat Protospacer
* . . *..************* *** *****
203. spacer 1.144|1362128|32|NZ_CP007030|PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
------gcatattatcattcgctggcggtttttccgct CRISPR spacer
ccggtggcg------catttgctggcggttttgccgct Protospacer
**. ****.************ *****
204. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to MN693179 (Marine virus AFVG_25M461, complete genome) position: , mismatch: 9, identity: 0.719
ttttgattttccattgtttcggtttccttact CRISPR spacer
agggaattttccattttttcggtttacttctt Protospacer
.********** ********* *** .*
205. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to KC131021 (Marine gokushovirus isolate GOM, complete genome) position: , mismatch: 9, identity: 0.719
ttttgattttccattgtttcggtttccttact CRISPR spacer
aattgattttccattgttacgtttttttaaac Protospacer
**************** ** ***..* * .
206. spacer 1.6|1358281|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688
attaaacccccgttatgttgcgcgcgtcctct CRISPR spacer
ttcgtgcccccgttatgctgcccgcgtcccgc Protospacer
*.. .***********.*** *******. .
207. spacer 1.16|1358882|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693899 (Marine virus AFVG_250M76, complete genome) position: , mismatch: 10, identity: 0.688
tgtagcacttagcccaatgacgcgcaggttag CRISPR spacer
ccgaatttatagtcccatgacgcgcaggttag Protospacer
. *.. . ***.** ****************
208. spacer 1.22|1359242|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN694655 (Marine virus AFVG_250M998, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
209. spacer 1.22|1359242|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN693695 (Marine virus AFVG_250M1000, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
210. spacer 1.22|1359242|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN694804 (Marine virus AFVG_250M999, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
211. spacer 1.22|1359242|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MN694412 (Marine virus AFVG_250M997, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
212. spacer 1.37|1360143|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 10, identity: 0.688
ttatccagccgcttaaaatgctcaattaacca CRISPR spacer
ggcaccagccgcttaaaattctctattggtga Protospacer
*************** *** ***... *
213. spacer 1.48|1360804|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gccatcaccgacgaaagcgggcatttgctggc Protospacer
. *.******** ******* ******
214. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT080590 (UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
215. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KY779848 (Staphylococcus phage qdsa001, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
216. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KX532239 (Staphylococcus phage StAP1, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
217. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to LC492751 (Staphylococcus phage KSAP7 genomic DNA, compelete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
218. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to JX194239 (Staphylococcus phage SA11, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
219. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to LC492752 (Staphylococcus phage KSAP11 genomic DNA, compelete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
220. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT080584 (UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
221. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT080587 (UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
222. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to AP019522 (Staphylococcal phage MR003 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
223. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_022090 (Staphylococcus phage vB_SauM_Remus, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
224. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to KP881332 (Staphylococcus phage Stau2, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
225. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT080588 (UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
226. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MT080595 (UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
227. spacer 1.67|1361947|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_020877 (Staphylococcus phage vB_SauM_Romulus, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
228. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_KY579372 (Enterococcus faecium strain F120805 substr. faecium plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
229. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_014475 (Enterococcus faecalis plasmid pWZ1668, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
230. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP030934 (Enterococcus gilvus strain CR1 plasmid pCR1B, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
231. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_MF580438 (Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
232. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
233. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_AP018541 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
234. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_019284 (Enterococcus faecalis plasmid pWZ7140, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
235. spacer 1.73|1362307|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_019213 (Enterococcus faecalis plasmid pWZ909, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
236. spacer 1.80|1358282|32|NZ_CP007030|PILER-CR matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 10, identity: 0.688
attaaacccccgttatgttgcgcgcgtcctct CRISPR spacer
ttcgtgcccccgttatgctgcccgcgtcccgc Protospacer
*.. .***********.*** *******. .
237. spacer 1.90|1358883|32|NZ_CP007030|PILER-CR matches to MN693899 (Marine virus AFVG_250M76, complete genome) position: , mismatch: 10, identity: 0.688
tgtagcacttagcccaatgacgcgcaggttag CRISPR spacer
ccgaatttatagtcccatgacgcgcaggttag Protospacer
. *.. . ***.** ****************
238. spacer 1.96|1359243|32|NZ_CP007030|PILER-CR matches to MN694655 (Marine virus AFVG_250M998, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
239. spacer 1.96|1359243|32|NZ_CP007030|PILER-CR matches to MN693695 (Marine virus AFVG_250M1000, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
240. spacer 1.96|1359243|32|NZ_CP007030|PILER-CR matches to MN694804 (Marine virus AFVG_250M999, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
241. spacer 1.96|1359243|32|NZ_CP007030|PILER-CR matches to MN694412 (Marine virus AFVG_250M997, complete genome) position: , mismatch: 10, identity: 0.688
aactaatcactgggtaaattagctggtcggtt CRISPR spacer
cgtactcctctgggtaaattagctggtatgtt Protospacer
.. .* ****************** ***
242. spacer 1.111|1360144|32|NZ_CP007030|PILER-CR matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 10, identity: 0.688
ttatccagccgcttaaaatgctcaattaacca CRISPR spacer
ggcaccagccgcttaaaattctctattggtga Protospacer
*************** *** ***... *
243. spacer 1.122|1360805|32|NZ_CP007030|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
aaaaccaccgacgcaagcgggaatttgcgcca CRISPR spacer
gccatcaccgacgaaagcgggcatttgctggc Protospacer
. *.******** ******* ******
244. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to MT080590 (UNVERIFIED: Staphylococcus phage vB_SauM_EW27, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
245. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to KY779848 (Staphylococcus phage qdsa001, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
246. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to KX532239 (Staphylococcus phage StAP1, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
247. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to LC492751 (Staphylococcus phage KSAP7 genomic DNA, compelete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
248. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to JX194239 (Staphylococcus phage SA11, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
249. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to LC492752 (Staphylococcus phage KSAP11 genomic DNA, compelete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
250. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to MT080584 (UNVERIFIED: Staphylococcus phage vB_SauM_EW15, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
251. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to MT080587 (UNVERIFIED: Staphylococcus phage vB_SauM_EW20, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
252. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to AP019522 (Staphylococcal phage MR003 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
253. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to NC_022090 (Staphylococcus phage vB_SauM_Remus, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
254. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to KP881332 (Staphylococcus phage Stau2, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
255. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to MT080588 (UNVERIFIED: Staphylococcus phage vB_SauM_EW22, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
256. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to MT080595 (UNVERIFIED: Staphylococcus phage vB_SauM_EW41, partial genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
257. spacer 1.141|1361948|32|NZ_CP007030|PILER-CR matches to NC_020877 (Staphylococcus phage vB_SauM_Romulus, complete genome) position: , mismatch: 10, identity: 0.688
gcgtgtctgtacccgcattaattgctcgtaaa CRISPR spacer
cttgaactgtaacggcattaattgctcgtgca Protospacer
. . ***** * ***************. *
258. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NZ_KY579372 (Enterococcus faecium strain F120805 substr. faecium plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
259. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NC_014475 (Enterococcus faecalis plasmid pWZ1668, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
260. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NZ_CP030934 (Enterococcus gilvus strain CR1 plasmid pCR1B, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
261. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NZ_MF580438 (Enterococcus faecium strain E35048 plasmid pE35048-oc, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
262. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to MH830362 (Enterococcus faecalis plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
263. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NZ_AP018541 (Enterococcus faecalis strain KUB3006 plasmid pKUB3006-3, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
264. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NC_019284 (Enterococcus faecalis plasmid pWZ7140, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
265. spacer 1.147|1362308|32|NZ_CP007030|PILER-CR matches to NC_019213 (Enterococcus faecalis plasmid pWZ909, complete sequence) position: , mismatch: 10, identity: 0.688
ttttgattttccattgtttcggtttccttact CRISPR spacer
tcaagattttctattttttcggtttccccttg Protospacer
*. *******.*** ***********.. .
266. spacer 1.19|1359062|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
aatcaggcgatgggttaaaccgtgtgctaaaa CRISPR spacer
tgggcggcgatggggcaaaccgtgtgctgggc Protospacer
. ********* .************...
267. spacer 1.29|1359662|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 11, identity: 0.656
attgcgtggcgttgcagttgctcatgctgtta CRISPR spacer
ggcccgtgacgttccagttgctcatgcaccag Protospacer
. . ****.**** ************* . .
268. spacer 1.65|1361826|32|NZ_CP007030|CRISPRCasFinder,CRT matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 11, identity: 0.656
agttgatcggattgccgatggtcgaatttgat CRISPR spacer
gcacgatcggattgccgttggtcgcataaagg Protospacer
. .************* ****** ** ..
269. spacer 1.93|1359063|32|NZ_CP007030|PILER-CR matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
aatcaggcgatgggttaaaccgtgtgctaaaa CRISPR spacer
tgggcggcgatggggcaaaccgtgtgctgggc Protospacer
. ********* .************...
270. spacer 1.103|1359663|32|NZ_CP007030|PILER-CR matches to NZ_CP045204 (Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence) position: , mismatch: 11, identity: 0.656
attgcgtggcgttgcagttgctcatgctgtta CRISPR spacer
ggcccgtgacgttccagttgctcatgcaccag Protospacer
. . ****.**** ************* . .
271. spacer 1.139|1361827|32|NZ_CP007030|PILER-CR matches to NC_022235 (Sphingomonas sp. ERG5 plasmid pCADAB1, complete sequence) position: , mismatch: 11, identity: 0.656
agttgatcggattgccgatggtcgaatttgat CRISPR spacer
gcacgatcggattgccgttggtcgcataaagg Protospacer
. .************* ****** ** ..
