Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017648 Escherichia coli O7:K1 str. CE10 plasmid pCE10B, complete sequence 0 crisprs NA 0 0 0 0
NC_017650 Escherichia coli O7:K1 str. CE10 plasmid pCE10D, complete sequence 0 crisprs NA 0 0 0 0
NC_017646 Escherichia coli O7:K1 str. CE10, complete sequence 3 crisprs c2c9_V-U4,DinG,cas3,DEDDh,csa3,PD-DExK,RT,WYL 0 1 13 0
NC_017647 Escherichia coli O7:K1 str. CE10 plasmid pCE10A, complete sequence 0 crisprs NA 0 0 1 0
NC_017649 Escherichia coli O7:K1 str. CE10 plasmid pCE10C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_017646
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017646_1 965737-965884 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017646_2 1495295-1495410 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017646_3 5114817-5114963 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017646_1 1.2|965825|32|NC_017646|CRISPRCasFinder 965825-965856 32 NZ_CP045060 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence 9736-9767 9 0.719
NC_017646_1 1.2|965825|32|NC_017646|CRISPRCasFinder 965825-965856 32 NZ_CP045053 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence 9737-9768 9 0.719
NC_017646_1 1.2|965825|32|NC_017646|CRISPRCasFinder 965825-965856 32 NZ_CP045057 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence 9736-9767 9 0.719

1. spacer 1.2|965825|32|NC_017646|CRISPRCasFinder matches to NZ_CP045060 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

2. spacer 1.2|965825|32|NC_017646|CRISPRCasFinder matches to NZ_CP045053 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

3. spacer 1.2|965825|32|NC_017646|CRISPRCasFinder matches to NZ_CP045057 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcactggtaacatactccacccgcccaccat	CRISPR spacer
tgtcctggtaacatgttccacccgcccggtgt	Protospacer
* . **********..***********. ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 533480 : 607647 77 Enterobacteria_phage(52.5%) capsid,portal,lysis,tRNA,terminase,tail,transposase,protease,head NA
DBSCAN-SWA_2 824648 : 836343 23 Escherichia_phage(38.1%) transposase,protease,integrase attL 812468:812484|attR 844012:844028
DBSCAN-SWA_3 1072216 : 1130632 81 Escherichia_phage(44.26%) capsid,portal,holin,terminase,tail,integrase,protease,head attL 1064715:1064731|attR 1104088:1104104
DBSCAN-SWA_4 1260459 : 1349639 120 Enterobacteria_phage(21.62%) capsid,portal,holin,tRNA,plate,terminase,tail,transposase,integrase,protease,head attL 1267513:1267527|attR 1337189:1337203
DBSCAN-SWA_5 1433678 : 1518677 91 Escherichia_phage(32.0%) capsid,portal,holin,terminase,tail,transposase,integrase,protease,head attL 1449007:1449021|attR 1470899:1470913
DBSCAN-SWA_6 1760873 : 1870858 129 Salmonella_phage(31.87%) capsid,portal,lysis,plate,terminase,tail,transposase,integrase,head attL 1770614:1770630|attR 1873410:1873426
DBSCAN-SWA_7 2371468 : 2380324 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_8 2430653 : 2521614 92 Enterobacteria_phage(46.43%) capsid,lysis,holin,tRNA,terminase,tail,head NA
DBSCAN-SWA_9 2924638 : 2983508 64 Escherichia_phage(53.7%) holin,terminase,tail,transposase,integrase,protease attL 2940785:2940801|attR 2980394:2980410
DBSCAN-SWA_10 3072364 : 3133050 54 Shigella_phage(31.82%) tail,transposase,tRNA,plate NA
DBSCAN-SWA_11 3453658 : 3521555 56 Enterobacteria_phage(60.0%) lysis,tRNA,transposase,integrase,protease attL 3461001:3461018|attR 3533274:3533291
DBSCAN-SWA_12 4817333 : 4864615 48 Burkholderia_phage(31.58%) holin,tRNA,plate,tail,transposase NA
DBSCAN-SWA_13 5200401 : 5278322 76 Enterobacteria_phage(38.0%) portal,lysis,terminase,tail,transposase,integrase,protease attL 5230211:5230226|attR 5255407:5255422
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017647
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44216 : 53997 12 Escherichia_phage(25.0%) transposase,integrase attL 36962:36974|attR 45146:45158
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage