Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015921 Borreliella bissettii DN127, complete sequence 0 crisprs NA 0 0 1 0
NC_015920 Borreliella bissettii DN127 plasmid lp56, complete sequence 0 crisprs NA 0 0 0 0
NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 0 crisprs NA 0 0 0 0
NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 1 crisprs NA 3 3 0 0
NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 0 crisprs NA 0 0 0 0
NC_015904 Borreliella bissettii DN127 plasmid cp32-4, complete sequence 0 crisprs NA 0 0 0 0
NC_015916 Borreliella bissettii DN127 plasmid lp28-3, complete sequence 0 crisprs NA 0 0 0 0
NC_015911 Borreliella bissettii DN127 plasmid cp9, complete sequence 0 crisprs NA 0 0 0 0
NC_015917 Borreliella bissettii DN127 plasmid lp28-4, complete sequence 0 crisprs NA 0 0 0 0
NC_015922 Borreliella bissettii DN127 plasmid lp25, complete sequence 0 crisprs NA 0 0 0 0
NC_015919 Borreliella bissettii DN127 plasmid lp54, complete sequence 0 crisprs NA 0 0 0 0
NC_015918 Borreliella bissettii DN127 plasmid lp28-7, complete sequence 0 crisprs NA 0 0 0 0
NC_015907 Borreliella bissettii DN127 plasmid cp26, complete sequence 0 crisprs NA 0 0 0 0
NC_015908 Borreliella bissettii DN127 plasmid cp32-3, complete sequence 0 crisprs NA 0 0 0 0
NC_015915 Borreliella bissettii DN127 plasmid lp17, complete sequence 0 crisprs NA 0 0 0 0
NC_015910 Borreliella bissettii DN127 plasmid cp32-7, complete sequence 0 crisprs NA 0 0 0 0
NC_015903 Borreliella bissettii DN127 plasmid cp32-11, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_015921
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 445793 : 455219 9 Streptococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_015905
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_015909
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015909_1 22160-22360 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015909.1 22328-22366 1 0.974
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015906.1 22316-22342 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015906.1 58447-58473 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015904.1 22383-22409 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015908.1 22977-23003 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015908.1 23010-23036 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015906.1 58501-58527 2 0.926
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015905.1 22311-22349 2 0.949
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015905.1 22344-22382 2 0.949

1. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to position: 22328-22366, mismatch: 1, identity: 0.974

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagcgtaaaaaacgaactta	Protospacer
**********************.****************

2. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to position: 22316-22342, mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaactgccaaaatagatagtttag	Protospacer
****** ***.****************

3. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to position: 58447-58473, mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaactgccaaaatagatagtttag	Protospacer
****** ***.****************

4. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to position: 22383-22409, mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgctaagatagatagcttag	Protospacer
*************.********.****

5. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to position: 22977-23003, mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaataccaaaatagatagtttag	Protospacer
********.*.****************

6. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to position: 23010-23036, mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaataccaaaatagatagtttag	Protospacer
********.*.****************

7. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to position: 58501-58527, mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatctctagtttag	Protospacer
**************** **.*******

8. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to position: 22311-22349, mismatch: 2, identity: 0.949

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagtgttaaaaatgaactta	Protospacer
************************* *****.*******

9. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to position: 22344-22382, mismatch: 2, identity: 0.949

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagtgttaaaaatgaactta	Protospacer
************************* *****.*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 22187-22213 0 1.0
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 22241-22267 0 1.0
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 22295-22333 0 1.0
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 46489-46515 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 23042-23068 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 13809-13835 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019003 Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence 22720-22746 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017422 Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence 10132-10158 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 22815-22841 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031407 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence 7425-7451 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031408 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence 12016-12042 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 11219-11245 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000948 Borreliella burgdorferi B31 plasmid cp32-1, complete sequence 22537-22563 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000952 Borreliella burgdorferi B31 plasmid cp32-7, complete sequence 22365-22391 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019846 Borreliella burgdorferi plasmid cp32-1, complete sequence 22513-22539 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 53205-53231 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 23042-23068 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_011731 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence 22731-22757 1 0.963
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 22377-22403 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017423 Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence 21181-21207 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 23096-23122 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 13863-13889 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017422 Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence 10186-10212 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031407 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence 7479-7505 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 11273-11299 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000952 Borreliella burgdorferi B31 plasmid cp32-7, complete sequence 22419-22445 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 23096-23122 1 0.963
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 22431-22457 1 0.963
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 22328-22366 1 0.974
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22349-22375 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22403-22429 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22457-22483 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22511-22537 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22565-22591 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 16793-16819 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 16880-16906 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 17359-17385 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 17479-17505 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 16824-16850 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 16944-16970 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017396 Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence 22392-22418 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017396 Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence 22446-22472 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 16824-16850 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 16944-16970 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 22478-22504 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 22619-22645 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 16824-16850 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 16944-16970 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_011735 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence 22493-22519 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_011735 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence 22547-22573 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017205 Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence 16825-16851 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017205 Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence 16912-16938 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 22562-22588 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 22703-22729 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP009071 Borreliella afzelii K78 plasmid cp32-5, complete sequence 16819-16845 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015904 Borreliella bissettii DN127 plasmid cp32-4, complete sequence 22383-22409 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 22316-22342 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 58447-58473 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015908 Borreliella bissettii DN127 plasmid cp32-3, complete sequence 22977-23003 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015908 Borreliella bissettii DN127 plasmid cp32-3, complete sequence 23010-23036 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031405 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence 10807-10833 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031405 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence 10948-10974 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 22367-22393 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 22508-22534 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP015802 Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence 9242-9268 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP015802 Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence 9383-9409 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 22321-22347 2 0.926
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 22462-22488 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015904 Borreliella bissettii DN127 plasmid cp32-4, complete sequence 22437-22463 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 10699-10725 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 58501-58527 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 15672-15698 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 52864-52890 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 22377-22403 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018984 Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence 22887-22913 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017398 Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence 22352-22378 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017400 Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence 8199-8225 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 53081-53107 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031411 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence 10277-10303 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP015799 Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence 20983-21009 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP015801 Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence 22317-22343 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019848 Borreliella burgdorferi plasmid cp32-4, complete sequence 22206-22232 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019849 Borreliella burgdorferi plasmid cp32-5, complete sequence 22387-22413 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 22388-22414 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019759 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence 22207-22233 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011736 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence 22680-22706 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017207 Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence 11317-11343 2 0.926
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017224 Borreliella afzelii PKo plasmid cp32-11, complete sequence 22091-22117 2 0.926
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22311-22349 2 0.949
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22344-22382 2 0.949
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 17446-17472 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 16911-16937 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 16911-16937 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 16911-16937 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 16852-16878 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017428 Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence 16715-16741 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017428 Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence 16802-16828 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22431-22457 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017227 Borreliella afzelii PKo plasmid cp32-5, complete sequence 16842-16868 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017423 Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence 21094-21120 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 46240-46266 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 46402-46428 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 22341-22367 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018979 Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence 22619-22645 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 16739-16765 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018984 Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence 22779-22805 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018984 Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence 22833-22859 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 53243-53269 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 22512-22538 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 22728-22754 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017396 Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence 22500-22526 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22485-22511 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22224-22250 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031410 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence 8333-8359 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031410 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence 8279-8305 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP015801 Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence 22263-22289 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP015801 Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence 22209-22235 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 52956-52982 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 53118-53144 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011735 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence 22601-22627 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011736 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence 22572-22598 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011736 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence 22626-22652 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 16798-16824 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019926 Borreliella burgdorferi strain PAbe plasmid p_lp56, complete sequence 20254-20280 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_019003 Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence 22471-22497 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_019003 Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence 22633-22659 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_019006 Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence 17305-17331 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017427 Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence 16770-16796 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017402 Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence 22322-22348 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017397 Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence 22180-22206 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017408 Borreliella burgdorferi JD1 plasmid JD1 lp28-6, complete sequence 25294-25320 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 16770-16796 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 16770-16796 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22579-22605 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015915 Borreliella bissettii DN127 plasmid lp17, complete sequence 25763-25789 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015915 Borreliella bissettii DN127 plasmid lp17, complete sequence 25817-25843 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031406 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence 22225-22251 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031408 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence 11713-11739 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031408 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence 11929-11955 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011722 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence 22289-22315 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000948 Borreliella burgdorferi B31 plasmid cp32-1, complete sequence 22288-22314 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000948 Borreliella burgdorferi B31 plasmid cp32-1, complete sequence 22450-22476 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 22357-22383 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 22341-22367 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000956 Borreliella burgdorferi B31 plasmid lp56, complete sequence 20254-20280 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019846 Borreliella burgdorferi plasmid cp32-1, complete sequence 22264-22290 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019846 Borreliella burgdorferi plasmid cp32-1, complete sequence 22426-22452 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 22270-22296 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019855 Borreliella burgdorferi plasmid lp56, complete sequence 20254-20280 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 22341-22367 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019766 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp56, complete sequence 20234-20260 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011731 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence 22428-22454 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011731 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence 22644-22670 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 22588-22614 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017205 Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence 16771-16797 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017206 Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence 22885-22911 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017206 Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence 22939-22965 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017240 Borreliella afzelii PKo plasmid lp32-10, complete sequence 19832-19858 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP028875 Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence 18272-18298 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017215 Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence 1341-1367 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017215 Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence 1482-1508 3 0.889
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017215 Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence 1536-1562 3 0.889
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017225 Borreliella afzelii PKo plasmid cp32-12, complete sequence 21784-21810 4 0.852
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019926 Borreliella burgdorferi strain PAbe plasmid p_lp56, complete sequence 20374-20400 4 0.852
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 16930-16956 4 0.852
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000956 Borreliella burgdorferi B31 plasmid lp56, complete sequence 20374-20400 4 0.852
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019855 Borreliella burgdorferi plasmid lp56, complete sequence 20374-20400 4 0.852
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019766 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp56, complete sequence 20354-20380 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 15834-15860 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 22515-22541 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 22539-22565 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017398 Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence 22514-22540 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031410 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence 8387-8413 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031411 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence 10439-10465 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP015799 Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence 21091-21117 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019849 Borreliella burgdorferi plasmid cp32-5, complete sequence 22549-22575 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 22550-22576 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017207 Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence 11479-11505 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 22757-22783 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017402 Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence 22529-22555 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 22673-22699 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22633-22659 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22687-22713 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22741-22767 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031406 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence 22399-22425 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_011722 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence 22343-22369 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 22411-22437 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 22465-22491 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 22519-22545 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 22515-22541 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 22444-22470 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 22515-22541 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 22642-22668 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 22696-22722 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 22750-22776 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017206 Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence 22993-23019 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_015903 Borreliella bissettii DN127 plasmid cp32-11, complete sequence 17100-17126 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP028864 Borreliella garinii strain 20047 plasmid cp32-3, complete sequence 13209-13235 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 22562-22588 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 22516-22542 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP018747 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed2 6282-6308 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP028874 Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence 22871-22897 4 0.852
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NC_023559 Oenococcus phage phi9805, complete genome 6796-6822 4 0.852
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015904 Borreliella bissettii DN127 plasmid cp32-4, complete sequence 16761-16799 4 0.897
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017425 Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence 22565-22591 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22459-22485 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017426 Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence 22546-22572 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 16939-16965 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_019005 Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence 22649-22675 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP009071 Borreliella afzelii K78 plasmid cp32-5, complete sequence 16798-16824 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031405 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence 10894-10920 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000951 Borreliella burgdorferi B31 plasmid cp32-6, complete sequence 22454-22480 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP015802 Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence 9329-9355 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017208 Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence 22408-22434 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017428 Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence 16889-16915 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 22461-22487 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 22377-22403 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017227 Borreliella afzelii PKo plasmid cp32-5, complete sequence 22646-22672 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP009063 Borreliella afzelii K78 plasmid lp28-2, complete sequence 1505-1531 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP018746 Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1 29453-29479 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017402 Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence 22475-22501 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017397 Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence 22300-22326 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_015903 Borreliella bissettii DN127 plasmid cp32-11, complete sequence 17274-17300 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP031406 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence 22345-22371 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP028865 Borreliella garinii strain 20047 plasmid lp36, complete sequence 7549-7575 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000953 Borreliella burgdorferi B31 plasmid cp32-8, complete sequence 22324-22350 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 22461-22487 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 22390-22416 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 22461-22487 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP015798 Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence 16882-16908 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 16975-17001 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP017203 Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence 22555-22581 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_017239 Borreliella afzelii PKo plasmid lp28-2, complete sequence 25119-25145 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 MN693532 Marine virus AFVG_25M340, complete genome 31738-31764 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 6026-6052 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NC_048753 Lactobacillus phage 3-521, complete genome 64410-64436 5 0.815
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 KY883638 Vibrio phage JSF13, complete genome 1100-1126 5 0.815
NC_015909_1 1.2|22241|27|NC_015909|CRISPRCasFinder 22241-22267 27 NZ_CP031405 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence 11002-11028 5 0.815
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP028880 Borreliella bavariensis PBi plasmid cp32-5, complete sequence 5232-5270 5 0.872
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 NZ_CP020460 Lactobacillus sakei strain FAM18311 plasmid pFAM18311_1 25966-25992 6 0.778
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 MN694659 Marine virus AFVG_250M322, complete genome 1303-1329 6 0.778
NC_015909_1 1.1|22187|27|NC_015909|CRISPRCasFinder 22187-22213 27 MG209611 Aphanizomenon phage vB_AphaS-CL131, complete genome 52388-52414 6 0.778
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 22262-22300 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 23117-23155 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019919 Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence 23150-23188 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 13884-13922 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_018980 Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence 13917-13955 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017422 Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence 10207-10245 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017422 Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence 10240-10278 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP031407 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence 7500-7538 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP031407 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence 7533-7571 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 11294-11332 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP028881 Borreliella bavariensis PBi plasmid cp32-7, complete sequence 11327-11365 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_000952 Borreliella burgdorferi B31 plasmid cp32-7, complete sequence 22440-22478 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_000952 Borreliella burgdorferi B31 plasmid cp32-7, complete sequence 22473-22511 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 23117-23155 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019757 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence 23150-23188 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 22452-22490 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP017209 Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence 22485-22523 6 0.846
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019918 Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence 15693-15731 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP009071 Borreliella afzelii K78 plasmid cp32-5, complete sequence 22408-22446 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_018981 Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence 22398-22436 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017398 Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence 22373-22411 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017400 Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence 8220-8258 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017394 Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence 53102-53140 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP031411 Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence 10298-10336 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP015799 Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence 21004-21042 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019849 Borreliella burgdorferi plasmid cp32-5, complete sequence 22408-22446 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019756 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence 22409-22447 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017227 Borreliella afzelii PKo plasmid cp32-5, complete sequence 22451-22489 7 0.821
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 16785-16823 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 22283-22321 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019921 Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence 16994-17032 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_011722 Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence 16942-16980 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_000954 Borreliella burgdorferi B31 plasmid cp32-9, complete sequence 16994-17032 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019850 Borreliella burgdorferi plasmid cp32-9, complete sequence 16923-16961 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP019760 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence 16994-17032 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017226 Borreliella afzelii PKo plasmid cp32-3, complete sequence 16785-16823 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017230 Borreliella afzelii PKo plasmid cp32-1, complete sequence 16783-16821 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015908 Borreliella bissettii DN127 plasmid cp32-3, complete sequence 17497-17535 8 0.795
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015906 Borreliella bissettii DN127 plasmid cp32-quad, complete sequence 58522-58560 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP009071 Borreliella afzelii K78 plasmid cp32-5, complete sequence 22495-22533 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_015903 Borreliella bissettii DN127 plasmid cp32-11, complete sequence 22628-22666 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017226 Borreliella afzelii PKo plasmid cp32-3, complete sequence 22943-22981 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017226 Borreliella afzelii PKo plasmid cp32-3, complete sequence 23030-23068 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP009070 Borreliella afzelii K78 plasmid cp32-3, complete sequence 22137-22175 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP009070 Borreliella afzelii K78 plasmid cp32-3, complete sequence 22224-22262 9 0.769
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017227 Borreliella afzelii PKo plasmid cp32-5, complete sequence 22484-22522 10 0.744
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NC_017227 Borreliella afzelii PKo plasmid cp32-5, complete sequence 22538-22576 10 0.744
NC_015909_1 1.3|22295|39|NC_015909|CRISPRCasFinder 22295-22333 39 NZ_CP009071 Borreliella afzelii K78 plasmid cp32-5, complete sequence 22441-22479 11 0.718

1. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgctaaaatagatagtttag	Protospacer
***************************

2. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatccagtttag	Protospacer
***************************

3. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 0, identity: 1.0

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagtgtaaaaaacgaactta	Protospacer
***************************************

4. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

5. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

6. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

7. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

8. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017422 (Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

9. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

10. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031407 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

11. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

12. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

13. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

14. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000952 (Borreliella burgdorferi B31 plasmid cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

15. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

16. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

17. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

18. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

19. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 1, identity: 0.963

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgccaaaatagatagtttag	Protospacer
**********.****************

20. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatccagtttag	Protospacer
 **************************

21. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

22. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

23. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017422 (Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

24. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031407 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

25. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

26. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000952 (Borreliella burgdorferi B31 plasmid cp32-7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

27. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

28. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 1, identity: 0.963

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccagtttag	Protospacer
****.**********************

29. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 1, identity: 0.974

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagcgtaaaaaacgaactta	Protospacer
**********************.****************

30. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

31. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

32. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

33. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

34. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

35. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

36. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

37. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

38. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

39. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

40. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

41. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

42. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

43. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

44. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

45. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

46. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

47. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

48. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

49. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

50. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

51. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

52. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtttag	Protospacer
.*********.****************

53. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

54. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

55. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP009071 (Borreliella afzelii K78 plasmid cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgctaagatagatggtttag	Protospacer
*************.******.******

56. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015904 (Borreliella bissettii DN127 plasmid cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatgctaagatagatagcttag	Protospacer
*************.********.****

57. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaactgccaaaatagatagtttag	Protospacer
****** ***.****************

58. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaactgccaaaatagatagtttag	Protospacer
****** ***.****************

59. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015908 (Borreliella bissettii DN127 plasmid cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaataccaaaatagatagtttag	Protospacer
********.*.****************

60. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015908 (Borreliella bissettii DN127 plasmid cp32-3, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaataccaaaatagatagtttag	Protospacer
********.*.****************

61. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031405 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

62. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031405 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

63. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

64. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

65. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

66. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

67. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

68. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 2, identity: 0.926

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagatagtttag	Protospacer
*.********.****************

69. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015904 (Borreliella bissettii DN127 plasmid cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttaa	Protospacer
*******************.******.

70. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttag	Protospacer
 ******************.*******

71. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatctctagtttag	Protospacer
**************** **.*******

72. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

73. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

74. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

75. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

76. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

77. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

78. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

79. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

80. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

81. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

82. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019848 (Borreliella burgdorferi plasmid cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

83. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

84. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

85. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019759 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

86. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtctag	Protospacer
*******************.***.***

87. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttgg	Protospacer
*******************.*****.*

88. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017224 (Borreliella afzelii PKo plasmid cp32-11, complete sequence) position: , mismatch: 2, identity: 0.926

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttacaaaaagatatatccaatttag	Protospacer
****.****************.*****

89. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.949

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagtgttaaaaatgaactta	Protospacer
************************* *****.*******

90. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 2, identity: 0.949

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaattctaaaatagatagtgttaaaaatgaactta	Protospacer
************************* *****.*******

91. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

92. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

93. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

94. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

95. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

96. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

97. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtag	Protospacer
.*********.************ ***

98. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgccaaaatagagagtttag	Protospacer
*.********.******** *******

99. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017227 (Borreliella afzelii PKo plasmid cp32-5, complete sequence) position: , mismatch: 3, identity: 0.889

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gcttaaatgctaagatagatggtttag	Protospacer
*.***********.******.******

100. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017423 (Borreliella burgdorferi N40 plasmid N40_cp32-12, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctaatttag	Protospacer
 ******************.*.*****

101. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

102. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

103. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

104. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018979 (Borrelia burgdorferi 297 plasmid 297_cp32-12, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

105. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

106. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

107. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018984 (Borrelia burgdorferi 297 plasmid 297_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

108. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttaa	Protospacer
 ******************.******.

109. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

110. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

111. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017396 (Borreliella burgdorferi JD1 plasmid JD1 cp32-12, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

112. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

113. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

114. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031410 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

115. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031410 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtgtaa	Protospacer
*******************.*** **.

116. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

117. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP015801 (Borrelia mayonii strain MN14-1539 plasmid cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtgtaa	Protospacer
*******************.*** **.

118. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

119. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

120. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011735 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-12, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

121. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

122. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011736 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtttga	Protospacer
*******************.*****..

123. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

124. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019926 (Borreliella burgdorferi strain PAbe plasmid p_lp56, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

125. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

126. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_019003 (Borrelia burgdorferi 297 plasmid 297_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

127. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_019006 (Borrelia burgdorferi 297 plasmid 297_cp32-3, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

128. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017427 (Borreliella burgdorferi JD1 plasmid JD1 cp32-3, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

129. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

130. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

131. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017408 (Borreliella burgdorferi JD1 plasmid JD1 lp28-6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

132. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

133. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

134. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttag	Protospacer
 ***.**************.*******

135. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015915 (Borreliella bissettii DN127 plasmid lp17, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

136. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015915 (Borreliella bissettii DN127 plasmid lp17, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

137. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

138. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

139. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031408 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

140. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

141. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

142. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000948 (Borreliella burgdorferi B31 plasmid cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

143. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttag	Protospacer
 ***.**************.*******

144. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

145. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000956 (Borreliella burgdorferi B31 plasmid lp56, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

146. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

147. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019846 (Borreliella burgdorferi plasmid cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

148. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

149. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019855 (Borreliella burgdorferi plasmid lp56, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

150. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagacatatctagtttag	Protospacer
 ************.*****.*******

151. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019766 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp56, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

152. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctagtttgg	Protospacer
 ******************.*****.*

153. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011731 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgaaaaaagatatatctagtttag	Protospacer
 **** *************.*******

154. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttag	Protospacer
 ***.**************.*******

155. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017205 (Borreliella burgdorferi strain B331 plasmid B331_cp32_11, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

156. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtgtaa	Protospacer
*******************.*** **.

157. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagtgtaa	Protospacer
*******************.*** **.

158. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017240 (Borreliella afzelii PKo plasmid lp32-10, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
gtttgtaaaaagatatatctagtttag	Protospacer
 ****.*************.*******

159. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP028875 (Borreliella bavariensis PBi plasmid lp28-4_cp32-1, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctaatttag	Protospacer
 ******************.*.*****

160. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017215 (Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

161. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017215 (Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

162. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017215 (Borreliella burgdorferi strain B331 plasmid B331_lp28_6, complete sequence) position: , mismatch: 3, identity: 0.889

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttag	Protospacer
 ***.****************.*****

163. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017225 (Borreliella afzelii PKo plasmid cp32-12, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatactaaaatagatagtgtaa	Protospacer
.*******.************** **.

164. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019926 (Borreliella burgdorferi strain PAbe plasmid p_lp56, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtgg	Protospacer
.*********.************ *.*

165. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgttg	Protospacer
.*********.************ * *

166. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000956 (Borreliella burgdorferi B31 plasmid lp56, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtgg	Protospacer
.*********.************ *.*

167. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019855 (Borreliella burgdorferi plasmid lp56, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtgg	Protospacer
.*********.************ *.*

168. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019766 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp56, complete sequence) position: , mismatch: 4, identity: 0.852

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtgg	Protospacer
.*********.************ *.*

169. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

170. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

171. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

172. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

173. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031410 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-4, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

174. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

175. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

176. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

177. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

178. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017207 (Borreliella burgdorferi strain B331 plasmid B331_cp32_5, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

179. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

180. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

181. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

182. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

183. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

184. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
gtttgcaaaaagatatatctaatttaa	Protospacer
 ******************.*.****.

185. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

186. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

187. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

188. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

189. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
gtttgcaaaaagatatatctaatttaa	Protospacer
 ******************.*.****.

190. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

191. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

192. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

193. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

194. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

195. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
gtttgcaaaaagatatatctaatttaa	Protospacer
 ******************.*.****.

196. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017206 (Borreliella burgdorferi strain B331 plasmid B331_cp32_4, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatctagtttaa	Protospacer
 ***.**************.******.

197. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_015903 (Borreliella bissettii DN127 plasmid cp32-11, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttacaaaaagatatatccaatttaa	Protospacer
 ***.****************.****.

198. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP028864 (Borreliella garinii strain 20047 plasmid cp32-3, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctattttaa	Protospacer
 ******************.* ****.

199. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

200. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctagcttga	Protospacer
*******************.**.**..

201. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP018747 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed2) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctattttaa	Protospacer
 ******************.* ****.

202. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP028874 (Borreliella bavariensis PBi plasmid lp25_cp32-3, complete sequence) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
atttgcaaaaagatatatctattttaa	Protospacer
 ******************.* ****.

203. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NC_023559 (Oenococcus phage phi9805, complete genome) position: , mismatch: 4, identity: 0.852

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ttatccaaagagatatatccagtttag	Protospacer
.* * ****.*****************

204. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015904 (Borreliella bissettii DN127 plasmid cp32-4, complete sequence) position: , mismatch: 4, identity: 0.897

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagataatgtagaaaa-gaatttac	Protospacer
*********************.****.**** ***.*** 

205. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017425 (Borreliella burgdorferi JD1 plasmid JD1 cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

206. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaatgctaaaatagatagtgtag	Protospacer
. .* ****************** ***

207. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017426 (Borreliella burgdorferi JD1 plasmid JD1 cp32-8, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaatgctaaaatagatagtgtag	Protospacer
. .* ****************** ***

208. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtta	Protospacer
.*********.************ * .

209. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_019005 (Borrelia burgdorferi 297 plasmid 297_cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

210. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP009071 (Borreliella afzelii K78 plasmid cp32-5, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aatttaatgctaaaatagatggtttaa	Protospacer
. ** ***************.*****.

211. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031405 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

212. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000951 (Borreliella burgdorferi B31 plasmid cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

213. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP015802 (Borrelia mayonii strain MN14-1539 plasmid cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

214. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017208 (Borreliella burgdorferi strain B331 plasmid B331_cp32_6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

215. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017428 (Borreliella burgdorferi JD1 plasmid JD1 cp32-10, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtta	Protospacer
.*********.************ * .

216. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

217. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

218. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017227 (Borreliella afzelii PKo plasmid cp32-5, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttgaatactaaaatagatagtgtta	Protospacer
****.***.************** * .

219. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP009063 (Borreliella afzelii K78 plasmid lp28-2, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aatttaatgctaaaatagatggtttaa	Protospacer
. ** ***************.*****.

220. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP018746 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aatttaatgccaaaatagatagtttaa	Protospacer
. ** *****.***************.

221. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017402 (Borreliella burgdorferi N40 plasmid N40_cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

222. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017397 (Borreliella burgdorferi JD1 plasmid JD1 cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

223. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_015903 (Borreliella bissettii DN127 plasmid cp32-11, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtta	Protospacer
.*********.************ * .

224. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP031406 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

225. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP028865 (Borreliella garinii strain 20047 plasmid lp36, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aatttaatgccaaaatagatagtttaa	Protospacer
. ** *****.***************.

226. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000953 (Borreliella burgdorferi B31 plasmid cp32-8, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaatgctaaaatagatagtgtag	Protospacer
. .* ****************** ***

227. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

228. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

229. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaattctaaaatagatagtttag	Protospacer
. .* *** ******************

230. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP015798 (Borrelia mayonii strain MN14-1539 plasmid cp32-1, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtta	Protospacer
.*********.************ * .

231. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
atttaaatgccaaaatagatagtgtta	Protospacer
.*********.************ * .

232. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP017203 (Borreliella burgdorferi strain B331 plasmid B331_cp32_1, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aacttaatgctaaaatagatagtgtag	Protospacer
. .* ****************** ***

233. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_017239 (Borreliella afzelii PKo plasmid lp28-2, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
aatttaatgctaaaatagatggtttaa	Protospacer
. ** ***************.*****.

234. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to MN693532 (Marine virus AFVG_25M340, complete genome) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
ctttaaatgctaaaaaagatacttttt	Protospacer
 ************** ***** ***  

235. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
ttccaaatgctaaattatatagtttag	Protospacer
 *..********** ** *********

236. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NC_048753 (Lactobacillus phage 3-521, complete genome) position: , mismatch: 5, identity: 0.815

gtttaa---atgctaaaatagatagtttag	CRISPR spacer
---taactgatgctaaaatagatagtttga	Protospacer
   ***   *******************..

237. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to KY883638 (Vibrio phage JSF13, complete genome) position: , mismatch: 5, identity: 0.815

gtttaaatgctaaaatagatagtttag	CRISPR spacer
gtttaaatactaaaatagatactctga	Protospacer
********.************ *.*..

238. spacer 1.2|22241|27|NC_015909|CRISPRCasFinder matches to NZ_CP031405 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-6, complete sequence) position: , mismatch: 5, identity: 0.815

ctttgcaaaaagatatatccagtttag	CRISPR spacer
ctttgcaaaaagatatatctggcttga	Protospacer
*******************..*.**..

239. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP028880 (Borreliella bavariensis PBi plasmid cp32-5, complete sequence) position: , mismatch: 5, identity: 0.872

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatactaagatagatagtgtaaaaaacgaactta	Protospacer
* .* *** ****.*************************

240. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to NZ_CP020460 (Lactobacillus sakei strain FAM18311 plasmid pFAM18311_1) position: , mismatch: 6, identity: 0.778

gtttaaatgctaaaatagatagtttag	CRISPR spacer
acataaataataaaatagatagtttaa	Protospacer
.. *****. ****************.

241. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to MN694659 (Marine virus AFVG_250M322, complete genome) position: , mismatch: 6, identity: 0.778

gtttaaatgctaaaatagatagtttag	CRISPR spacer
tactaaatgataaaaaagatagtttat	Protospacer
  .****** ***** ********** 

242. spacer 1.1|22187|27|NC_015909|CRISPRCasFinder matches to MG209611 (Aphanizomenon phage vB_AphaS-CL131, complete genome) position: , mismatch: 6, identity: 0.778

gtttaaatgctaaaatagatagtttag	CRISPR spacer
ctttaaatgcaaaaatagaaagttctc	Protospacer
 ********* ******** ****.  

243. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

244. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

245. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019919 (Borreliella burgdorferi strain PAbe plasmid p_cp32-2, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

246. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

247. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_018980 (Borrelia burgdorferi 297 plasmid 297_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

248. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017422 (Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

249. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017422 (Borreliella burgdorferi N40 plasmid N40_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

250. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP031407 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

251. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP031407 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

252. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

253. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP028881 (Borreliella bavariensis PBi plasmid cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

254. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_000952 (Borreliella burgdorferi B31 plasmid cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

255. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_000952 (Borreliella burgdorferi B31 plasmid cp32-7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

256. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

257. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019757 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-2, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

258. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatactaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** ******************************

259. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP017209 (Borreliella burgdorferi strain B331 plasmid B331_cp32_7, complete sequence) position: , mismatch: 6, identity: 0.846

aacttaattctaaaatagatagtgtaaaaaacgaactta-	CRISPR spacer
aacttaattctaaaatagatagtatagaaaa-aaccttgc	Protospacer
***********************.**.**** .* ***. 

260. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019918 (Borreliella burgdorferi strain PAbe plasmid p_cp32-5-1, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

261. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP009071 (Borreliella afzelii K78 plasmid cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gcttagatgcgaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** * ****************************

262. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_018981 (Borrelia burgdorferi 297 plasmid 297_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

263. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017398 (Borreliella burgdorferi N40 plasmid N40_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

264. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017400 (Borreliella burgdorferi N40 plasmid N40_cp32-4, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

265. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017394 (Borreliella burgdorferi JD1 plasmid JD1 cp32-1+5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

266. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP031411 (Borreliella burgdorferi strain MM1 plasmid plsm_cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

267. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP015799 (Borrelia mayonii strain MN14-1539 plasmid cp32-13, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

268. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019849 (Borreliella burgdorferi plasmid cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

269. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019756 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-1_1, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttggatactaaaatagatagtgtaaaaaacgagctta	Protospacer
. .* .** *************************.****

270. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017227 (Borreliella afzelii PKo plasmid cp32-5, complete sequence) position: , mismatch: 7, identity: 0.821

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gcttagatgcgaaaatagatagtgtaaaaaacgaactta	Protospacer
. .* .** * ****************************

271. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatctaaaaatagatagtgttaaaaatgaactta	Protospacer
* .* ***.. ************** *****.*******

272. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatattaaaatagataatgtaaaaaacgaactta	Protospacer
. .* .** .***********.*****************

273. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019921 (Borreliella burgdorferi strain PAbe plasmid p_cp32-9-4, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatgtcaaaatagatagtgttaaaagcgaactta	Protospacer
* .* *** ..************** ****.********

274. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_011722 (Borreliella burgdorferi ZS7 plasmid ZS7_cp32-9, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatgtcaaaatagatagtgttaaaagcgaactta	Protospacer
* .* *** ..************** ****.********

275. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_000954 (Borreliella burgdorferi B31 plasmid cp32-9, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatgtcaaaatagatagtgttaaaagcgaactta	Protospacer
* .* *** ..************** ****.********

276. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019850 (Borreliella burgdorferi plasmid cp32-9, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatgtcaaaatagatagtgttaaaagcgaactta	Protospacer
* .* *** ..************** ****.********

277. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP019760 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp32-9, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatgtcaaaatagatagtgttaaaagcgaactta	Protospacer
* .* *** ..************** ****.********

278. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017226 (Borreliella afzelii PKo plasmid cp32-3, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagagactaaaatagatagtgtaaaaaatgaactta	Protospacer
. .* .*  **********************.*******

279. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017230 (Borreliella afzelii PKo plasmid cp32-1, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagagactaaaatagatagtgtaaaaaatgaactta	Protospacer
. .* .*  **********************.*******

280. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015908 (Borreliella bissettii DN127 plasmid cp32-3, complete sequence) position: , mismatch: 8, identity: 0.795

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttaaatataaaaatagatagtgttaaaaatgaactta	Protospacer
* .* *** . ************** *****.*******

281. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015906 (Borreliella bissettii DN127 plasmid cp32-quad, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatattaaaatagacaatgtaaaaaacgaactta	Protospacer
. .* .** .*********.*.*****************

282. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP009071 (Borreliella afzelii K78 plasmid cp32-5, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcaaaaatagatagtgtaaataccaagatag	Protospacer
******** * ***************** * *.*. * .

283. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_015903 (Borreliella bissettii DN127 plasmid cp32-11, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
atttagatataaaaatagatagtgttaaaaatgaactta	Protospacer
* .* .** . ************** *****.*******

284. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017226 (Borreliella afzelii PKo plasmid cp32-3, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatgtgaaaatagacagtgtaaaaaacgaactta	Protospacer
. .* .** . ********.*******************

285. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017226 (Borreliella afzelii PKo plasmid cp32-3, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcaaaaatagatagtgtaaataccaagatag	Protospacer
******** * ***************** * *.*. * .

286. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP009070 (Borreliella afzelii K78 plasmid cp32-3, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
gtttagatgtgaaaatagacagtgtaaaaaacgaactta	Protospacer
. .* .** . ********.*******************

287. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP009070 (Borreliella afzelii K78 plasmid cp32-3, complete sequence) position: , mismatch: 9, identity: 0.769

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcaaaaatagatagtgtaaataccaagatag	Protospacer
******** * ***************** * *.*. * .

288. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017227 (Borreliella afzelii PKo plasmid cp32-5, complete sequence) position: , mismatch: 10, identity: 0.744

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcgaaaatagatagtgtaaatactaagatag	Protospacer
******** * ***************** * ..*. * .

289. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NC_017227 (Borreliella afzelii PKo plasmid cp32-5, complete sequence) position: , mismatch: 10, identity: 0.744

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcgaaaatagatagtgtaaatactaagatag	Protospacer
******** * ***************** * ..*. * .

290. spacer 1.3|22295|39|NC_015909|CRISPRCasFinder matches to NZ_CP009071 (Borreliella afzelii K78 plasmid cp32-5, complete sequence) position: , mismatch: 11, identity: 0.718

aacttaattctaaaatagatagtgtaaaaaacgaactta	CRISPR spacer
aacttaatgcgaaaatagatagtgtaaatgctaagatag	Protospacer
******** * ***************** . ..*. * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_015906
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_015908
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NC_015904
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage