Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP007808 Brevibacillus laterosporus LMG 15441 plasmid pBRLA07, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP007807 Brevibacillus laterosporus LMG 15441 plasmid pBRLA33, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP007806 Brevibacillus laterosporus LMG 15441 chromosome, complete genome 2 crisprs csa3,cas14j,cas3,RT,DinG,WYL,DEDDh 0 1 5 0

Results visualization

1. NZ_CP007806
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007806_1 1243919-1244042 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP007806_2 3375361-3375476 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP007806_2 2.1|3375390|58|NZ_CP007806|CRISPRCasFinder 3375390-3375447 58 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 1363312-1363369 3 0.948

1. spacer 2.1|3375390|58|NZ_CP007806|CRISPRCasFinder matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.948

agaaatagagcttccttcgaaaaccactatctctgaatcacccaacacgctagaacaa	CRISPR spacer
agaaatagaacttccttcgaaaaccactatctctgaatcgcccaacacgctagaacag	Protospacer
*********.*****************************.*****************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 611989 : 618880 9 Pneumococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 2205016 : 2249787 37 Brevibacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 2353191 : 2362790 10 Bacillus_virus(55.56%) NA NA
DBSCAN-SWA_4 3407741 : 3489778 79 Brevibacillus_phage(73.17%) integrase,tRNA,tail,capsid,transposase,holin,plate attL 3404448:3404468|attR 3460091:3460111
DBSCAN-SWA_5 3499795 : 3516036 30 Brevibacillus_phage(40.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage