Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017580 Shewanella baltica OS117 plasmid pSBAL11702, complete sequence 0 crisprs NA 0 0 0 0
NC_017578 Shewanella baltica OS117 plasmid pSBAL11703, complete sequence 0 crisprs RT 0 0 1 0
NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 4 crisprs NA 1 6 0 0
NC_017579 Shewanella baltica OS117, complete sequence 2 crisprs csa3,DEDDh,PD-DExK,cas3,WYL,DinG,RT,TnsE_C 0 1 15 0

Results visualization

1. NC_017578
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1011 : 41815 35 Acidithiobacillus_phage(15.38%) integrase,transposase attL 7384:7398|attR 22861:22875
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_017577
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017577_1 37093-37232 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017577_2 37336-37618 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017577_3 51001-51095 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017577_4 63720-63818 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_017577_2 2.2|37475|40|NC_017577|CRISPRCasFinder 37475-37514 40 NC_017577.1 37595-37634 1 0.975

1. spacer 2.2|37475|40|NC_017577|CRISPRCasFinder matches to position: 37595-37634, mismatch: 1, identity: 0.975

tgtcgatacacgacagtttttaagtgtcgatacacaacag	CRISPR spacer
tgtcgatacacgacagtttttaagtgtcgatacacgacag	Protospacer
***********************************.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017577_2 2.2|37475|40|NC_017577|CRISPRCasFinder 37475-37514 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37475-37514 0 1.0
NC_017577_2 2.3|37547|40|NC_017577|CRISPRCasFinder 37547-37586 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37547-37586 0 1.0
NC_017577_3 3.1|51033|31|NC_017577|CRISPRCasFinder 51033-51063 31 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 51033-51063 0 1.0
NC_017577_4 4.1|63744|51|NC_017577|CRISPRCasFinder 63744-63794 51 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 63744-63794 0 1.0
NC_017577_2 2.2|37475|40|NC_017577|CRISPRCasFinder 37475-37514 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37595-37634 1 0.975
NC_017577_4 4.1|63744|51|NC_017577|CRISPRCasFinder 63744-63794 51 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 63669-63719 1 0.98
NC_017577_2 2.2|37475|40|NC_017577|CRISPRCasFinder 37475-37514 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37571-37610 2 0.95
NC_017577_2 2.3|37547|40|NC_017577|CRISPRCasFinder 37547-37586 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37595-37634 3 0.925
NC_017577_3 3.1|51033|31|NC_017577|CRISPRCasFinder 51033-51063 31 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 50970-51000 4 0.871
NC_017577_2 2.2|37475|40|NC_017577|CRISPRCasFinder 37475-37514 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37451-37490 5 0.875
NC_017577_2 2.3|37547|40|NC_017577|CRISPRCasFinder 37547-37586 40 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37101-37140 11 0.725
NC_017577_1 1.1|37125|75|NC_017577|CRISPRCasFinder 37125-37199 75 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37125-37199 15 0.8
NC_017577_2 2.1|37368|75|NC_017577|CRISPRCasFinder 37368-37442 75 NC_017577 Shewanella baltica OS117 plasmid pSBAL11701, complete sequence 37368-37442 15 0.8

1. spacer 2.2|37475|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcgatacacgacagtttttaagtgtcgatacacaacag	CRISPR spacer
tgtcgatacacgacagtttttaagtgtcgatacacaacag	Protospacer
****************************************

2. spacer 2.3|37547|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcaatacacgacagtttttaagtgtcgatacccgacag	CRISPR spacer
cgtcaatacacgacagtttttaagtgtcgatacccgacag	Protospacer
****************************************

3. spacer 3.1|51033|31|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 0, identity: 1.0

actaagtcatcctgagttcggatttcgctac	CRISPR spacer
actaagtcatcctgagttcggatttcgctac	Protospacer
*******************************

4. spacer 4.1|63744|51|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 0, identity: 1.0

accaatggccgaggcgggtaattcagcaccggctaccaatggtcctgcagt	CRISPR spacer
accaatggccgaggcgggtaattcagcaccggctaccaatggtcctgcagt	Protospacer
***************************************************

5. spacer 2.2|37475|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 1, identity: 0.975

tgtcgatacacgacagtttttaagtgtcgatacacaacag	CRISPR spacer
tgtcgatacacgacagtttttaagtgtcgatacacgacag	Protospacer
***********************************.****

6. spacer 4.1|63744|51|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 1, identity: 0.98

accaatggccgaggcgggtaattcagcaccggctaccaatggtcctgcagt	CRISPR spacer
accaatggccgaggcgggtaattcagcaccggctaccaatggtcctgcagc	Protospacer
**************************************************.

7. spacer 2.2|37475|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 2, identity: 0.95

tgtcgatacacgacagtttttaagtgtcgatacacaacag	CRISPR spacer
tgtcgatacccgacagtttttaagtgtcgatacacgacag	Protospacer
********* *************************.****

8. spacer 2.3|37547|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 3, identity: 0.925

cgtcaatacacgacagtttttaagtgtcgatacccgacag	CRISPR spacer
tgtcgatacacgacagtttttaagtgtcgatacacgacag	Protospacer
.***.**************************** ******

9. spacer 3.1|51033|31|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 4, identity: 0.871

actaagtcatcctgagttcggatttcgctac	CRISPR spacer
tctaagtcatcctgagttcgaatttcgccat	Protospacer
 *******************.*******.*.

10. spacer 2.2|37475|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 5, identity: 0.875

tgtcgatacacgacagtttttaagtgtcgatacacaacag	CRISPR spacer
cgttaatacccgacagtttttaagtgtcgatacacgacag	Protospacer
.**..**** *************************.****

11. spacer 2.3|37547|40|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 11, identity: 0.725

cgtcaatacacgacagtttttaagtgtcgat--acccgacag	CRISPR spacer
tgccaatacactacagtttttaagtgttgattgaattaat--	Protospacer
.*.******** ***************.***  * ...*.  

12. spacer 1.1|37125|75|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 15, identity: 0.8

tgttgattgaattaatgactatttttaagaaaattatacatggttatcttttgttgcatt	CRISPR spacer
tgttgattgaattaatgactatttttaagaaaattatacatggttatcttttgttgcatt	Protospacer
************************************************************

13. spacer 2.1|37368|75|NC_017577|CRISPRCasFinder matches to NC_017577 (Shewanella baltica OS117 plasmid pSBAL11701, complete sequence) position: , mismatch: 15, identity: 0.8

tgttgactgtattaaagctatttttagaagaagttacacataaaccgataccgtataatt	CRISPR spacer
tgttgactgtattaaagctatttttagaagaagttacacataaaccgataccgtataatt	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_017579
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017579_1 1719663-1719769 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017579_2 5176896-5176971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017579_2 2.1|5176920|28|NC_017579|CRISPRCasFinder 5176920-5176947 28 NC_014841 Pantoea sp. At-9b plasmid pPAT9B04, complete sequence 246254-246281 6 0.786

1. spacer 2.1|5176920|28|NC_017579|CRISPRCasFinder matches to NC_014841 (Pantoea sp. At-9b plasmid pPAT9B04, complete sequence) position: , mismatch: 6, identity: 0.786

taaacttatgtacaaactttactgttta	CRISPR spacer
gaaacatttgtacaaactttactgtgcc	Protospacer
 **** * ***************** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 197026 : 210763 9 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_2 1338425 : 1415914 51 Cyanophage(23.08%) transposase,integrase attL 1368414:1368473|attR 1419843:1421513
DBSCAN-SWA_3 1547775 : 1613210 69 Pseudoalteromonas_phage(54.84%) plate,head,terminase,holin,transposase,portal,tail,capsid NA
DBSCAN-SWA_4 1939434 : 2021436 58 Enterobacteria_phage(12.5%) transposase,tRNA,integrase,protease attL 1938637:1938696|attR 2019136:2021530
DBSCAN-SWA_5 2425313 : 2497117 52 Acinetobacter_phage(15.38%) transposase NA
DBSCAN-SWA_6 2515971 : 2586965 55 uncultured_Caudovirales_phage(15.38%) transposase,tRNA,protease NA
DBSCAN-SWA_7 2599376 : 2610925 12 uncultured_Caudovirales_phage(28.57%) tRNA NA
DBSCAN-SWA_8 2874999 : 2883651 11 Yellowstone_lake_phycodnavirus(16.67%) NA NA
DBSCAN-SWA_9 3150361 : 3222861 46 Acinetobacter_phage(20.0%) transposase NA
DBSCAN-SWA_10 3743078 : 3754504 8 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_11 3790736 : 3798332 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_12 4185833 : 4333168 118 Vibrio_phage(18.42%) tRNA,terminase,transposase,portal,integrase,tail,protease attL 4187729:4187743|attR 4341449:4342684
DBSCAN-SWA_13 4374098 : 4418266 43 Bacillus_virus(25.0%) transposase,protease NA
DBSCAN-SWA_14 4439367 : 4521049 51 Enterobacteria_phage(25.0%) transposase,integrase attL 4450347:4450364|attR 4512925:4512942
DBSCAN-SWA_15 5142928 : 5204708 43 Shigella_phage(16.67%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage