Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015519 Tepidanaerobacter acetatoxydans Re1, complete sequence 9 crisprs cas8b1,cas7b,cas5,cas3,cas2,csx1,cas10,csm3gr7,csx10gr5,csx19,csx20,csa3,WYL,cas3HD,cmr6gr7,cmr4gr7,cmr5gr11,cmr3gr5,DEDDh,cas4 0 3 3 0

Results visualization

1. NC_015519
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_1 121348-121520 TypeI NA
2 spacers
cas3,cas5,cas7b,cas8b1,cas6,cas2,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_2 131159-132392 TypeI NA
18 spacers
cas2,cas3,csx1,cas10,csm3gr7,csx10gr5,csx19,csx20

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_3 142412-143040 TypeIII NA
9 spacers
csx20,csm3gr7,csx19,csx10gr5,cas10,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_4 147435-148400 TypeIII NA
14 spacers
csx20,csm3gr7,csx19,csx10gr5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_5 237134-240204 Orphan NA
45 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_6 240330-241439 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_7 1375124-1375237 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_8 1766917-1767033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015519_9 2540966-2541092 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015519_2 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT 131657-131691 35 MK448998 Streptococcus phage Javan636, complete genome 7076-7110 7 0.8
NC_015519_4 4.6|147799|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT 147799-147834 36 LR694610 Escherichia phage rV5_ev168 genome assembly, chromosome: 1 109903-109938 7 0.806
NC_015519_4 4.6|147799|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT 147799-147834 36 LR694611 Escherichia phage rV5_ev158 genome assembly, chromosome: 1 109955-109990 7 0.806
NC_015519_2 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT 131657-131691 35 NZ_CP018741 Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence 152926-152960 9 0.743
NC_015519_2 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT 131657-131691 35 NZ_CP018741 Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence 159466-159500 9 0.743
NC_015519_2 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT 131657-131691 35 HM452126 Aeromonas phage phiAS5, complete genome 5323-5357 9 0.743
NC_015519_2 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT 131657-131691 35 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 55477-55511 10 0.714
NC_015519_2 2.17|132259|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT 132259-132294 36 MN694515 Marine virus AFVG_250M511, complete genome 10209-10244 11 0.694

1. spacer 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to MK448998 (Streptococcus phage Javan636, complete genome) position: , mismatch: 7, identity: 0.8

attgcttcttcaacacctttttcaattccagtgtg	CRISPR spacer
attgcttcttcaacacctttttcaaatgcttcgaa	Protospacer
************************* * *  .* .

2. spacer 4.6|147799|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to LR694610 (Escherichia phage rV5_ev168 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.806

aaatatgaatttatagataaaatggagcaacaaggc	CRISPR spacer
aaactgtaatatataaataaaatggagcaacaagcc	Protospacer
***.   *** ****.****************** *

3. spacer 4.6|147799|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to LR694611 (Escherichia phage rV5_ev158 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.806

aaatatgaatttatagataaaatggagcaacaaggc	CRISPR spacer
aaactgtaatatataaataaaatggagcaacaagcc	Protospacer
***.   *** ****.****************** *

4. spacer 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018741 (Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence) position: , mismatch: 9, identity: 0.743

attgcttcttcaacacctttttcaattccagtgtg	CRISPR spacer
ttgccttcttcaatacctttttcaatacctttttt	Protospacer
 *  *********.************ **  * * 

5. spacer 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018741 (Bacillus cereus strain FORC_047 plasmid pFORC47_1, complete sequence) position: , mismatch: 9, identity: 0.743

attgcttcttcaacacctttttcaattccagtgtg	CRISPR spacer
ttgccttcttcaatacctttttcaatacctttttt	Protospacer
 *  *********.************ **  * * 

6. spacer 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to HM452126 (Aeromonas phage phiAS5, complete genome) position: , mismatch: 9, identity: 0.743

attgcttcttcaacacctttttcaattccagtgtg	CRISPR spacer
tttgctacttcaacacgtttttcaatagcatcgac	Protospacer
 ***** ********* *********  ** .*  

7. spacer 2.8|131657|35|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 10, identity: 0.714

attgcttcttcaacacctttttcaattccagtgtg	CRISPR spacer
attgcatcttcaacacatttttcaatgttttcatt	Protospacer
***** ********** ********* ..  ..* 

8. spacer 2.17|132259|36|NC_015519|PILER-CR,CRISPRCasFinder,CRT matches to MN694515 (Marine virus AFVG_250M511, complete genome) position: , mismatch: 11, identity: 0.694

tttggtatgattttcagggtgttggtggtagaacag	CRISPR spacer
attggtctgattttgagggtgttggtgtaggcttta	Protospacer
 ***** ******* ************  .*  . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 937059 : 989680 54 Erysipelothrix_phage(18.18%) protease,tRNA,transposase NA
DBSCAN-SWA_2 1080515 : 1110461 48 Paenibacillus_phage(10.71%) capsid,portal,terminase,head,transposase,integrase,tail attL 1083770:1083829|attR 1110552:1110638
DBSCAN-SWA_3 2466061 : 2556135 94 Erysipelothrix_phage(20.45%) capsid,portal,bacteriocin,protease,terminase,head,holin,tRNA,transposase,integrase,tail attL 2493995:2494018|attR 2526494:2526517
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage