Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_015053 Bifidobacterium longum subsp. infantis 157F plasmid p157F-NC1, complete sequence 0 crisprs NA 0 0 0 0
NC_015066 Bifidobacterium longum subsp. infantis 157F plasmid p157F-NC2, complete sequence 0 crisprs NA 0 0 0 0
NC_015052 Bifidobacterium longum subsp. infantis 157F, complete genome 5 crisprs RT,c2c9_V-U4,WYL,DEDDh,casR 0 1 3 0

Results visualization

1. NC_015052
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015052_1 164530-164898 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015052_2 284506-284591 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015052_3 1492972-1493052 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015052_4 2006736-2006821 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_015052_5 2144667-2144740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_015052_1 1.5|164791|24|NC_015052|CRISPRCasFinder 164791-164814 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
NC_015052_1 1.5|164791|24|NC_015052|CRISPRCasFinder 164791-164814 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833

1. spacer 1.5|164791|24|NC_015052|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atcggttccgcagccggctgccgg	CRISPR spacer
atcggttccgcagcgggcagccgt	Protospacer
************** *** **** 

2. spacer 1.5|164791|24|NC_015052|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

atcggttccgcagccggctgccgg	CRISPR spacer
gtcggttccgccgccggctgcctc	Protospacer
.********** **********  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47095 : 119674 57 uncultured_Mediterranean_phage(15.38%) transposase,integrase,protease,tRNA attL 117374:117433|attR 120765:120860
DBSCAN-SWA_2 409086 : 490505 55 Staphylococcus_prophage(27.27%) transposase,integrase attL 409036:409095|attR 490497:491896
DBSCAN-SWA_3 1202041 : 1239964 44 Bifidobacterium_phage(44.44%) transposase,terminase,portal,integrase,tail,tRNA attL 1207584:1207600|attR 1222461:1222477
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage