Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008538 Arthrobacter sp. FB24 plasmid 2, complete sequence 0 crisprs csa3 0 0 0 0
NC_008539 Arthrobacter sp. FB24 plasmid 3, complete sequence 0 crisprs csa3 0 0 0 0
NC_008541 Arthrobacter sp. FB24, complete genome 4 crisprs csa3,cas3,DinG,WYL,DEDDh 0 1 0 0
NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 0 crisprs csa3,PD-DExK 0 0 0 0

Results visualization

1. NC_008541
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008541_1 135282-135356 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008541_2 1576907-1577004 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008541_4 3596487-3596581 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008541_3 3596187-3596282 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008541_1 1.1|135306|27|NC_008541|CRISPRCasFinder 135306-135332 27 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 532682-532708 4 0.852

1. spacer 1.1|135306|27|NC_008541|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 4, identity: 0.852

cagccggggtatggccaaccggaatac	CRISPR spacer
cagctggggtagggccaaccggagcac	Protospacer
****.****** ***********..**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage