Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007973 Cupriavidus metallidurans CH34, complete genome 0 crisprs csa3,DinG,PD-DExK,RT,DEDDh,WYL,cas3 0 0 8 0
NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1 crisprs WYL,DEDDh,cas3,csa3 0 1 1 0
NC_007972 Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence 0 crisprs NA 0 0 2 0
NC_007971 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_007973
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 303017 : 344119 37 Tupanvirus(14.29%) transposase,integrase,protease,tRNA attL 312076:312093|attR 345889:345906
DBSCAN-SWA_2 803083 : 811926 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 1334904 : 1426241 85 Bacillus_phage(11.11%) transposase,integrase,tRNA attL 1341162:1341178|attR 1416185:1416200
DBSCAN-SWA_4 1611194 : 1668018 49 uncultured_virus(33.33%) protease,transposase NA
DBSCAN-SWA_5 2162058 : 2175276 16 Pseudomonas_phage(50.0%) transposase,integrase,tRNA attL 2168337:2168396|attR 2178054:2181521
DBSCAN-SWA_6 3085379 : 3149401 51 Staphylococcus_phage(11.76%) tRNA,integrase,protease,transposase attL 3074074:3074089|attR 3116369:3116384
DBSCAN-SWA_7 3168129 : 3178527 9 Roseobacter_phage(14.29%) NA NA
DBSCAN-SWA_8 3707689 : 3713754 9 uncultured_Caudovirales_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007974
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007974_1 458453-458535 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007974_1 1.1|458479|31|NC_007974|CRISPRCasFinder 458479-458509 31 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 458479-458509 0 1.0
NC_007974_1 1.1|458479|31|NC_007974|CRISPRCasFinder 458479-458509 31 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 588742-588772 0 1.0
NC_007974_1 1.1|458479|31|NC_007974|CRISPRCasFinder 458479-458509 31 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 92699-92729 7 0.774
NC_007974_1 1.1|458479|31|NC_007974|CRISPRCasFinder 458479-458509 31 NZ_CP007517 Rubrobacter radiotolerans strain RSPS-4 plasmid 3, complete sequence 30464-30494 9 0.71

1. spacer 1.1|458479|31|NC_007974|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 0, identity: 1.0

cggcgagtccgcggggacccgggtgccggca	CRISPR spacer
cggcgagtccgcggggacccgggtgccggca	Protospacer
*******************************

2. spacer 1.1|458479|31|NC_007974|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 0, identity: 1.0

cggcgagtccgcggggacccgggtgccggca	CRISPR spacer
cggcgagtccgcggggacccgggtgccggca	Protospacer
*******************************

3. spacer 1.1|458479|31|NC_007974|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774

cggcgagtccgcggggacccgggtgccggca	CRISPR spacer
ggcccggtccgccgggaccggggtgccggcc	Protospacer
 * * .****** ****** ********** 

4. spacer 1.1|458479|31|NC_007974|CRISPRCasFinder matches to NZ_CP007517 (Rubrobacter radiotolerans strain RSPS-4 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.71

cggcgagtccgcggggacccgggtgccggca	CRISPR spacer
gctggtgttcgcgggcacccgggtgccggtg	Protospacer
    * **.****** *************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2156821 : 2224536 59 Tetraselmis_virus(25.0%) transposase,holin,integrase attL 2183529:2183546|attR 2222346:2222363
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_007972
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6170 : 64483 55 Salmonella_phage(22.22%) transposase,integrase NA
DBSCAN-SWA_2 98747 : 138475 31 Acidithiobacillus_phage(25.0%) transposase,integrase attL 124238:124259|attR 137101:137122
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_007971
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50916 : 121533 55 Bacillus_phage(15.38%) integrase,transposase attL 56002:56061|attR 123097:123805
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage