Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_002928 Bordetella parapertussis 12822, complete genome 7 crisprs RT,csa3,DEDDh,cas3,DinG 1 0 1 0

Results visualization

1. NC_002928
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_1 822409-822565 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_2 1052357-1052443 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_3 2198758-2198844 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_4 3091381-3091477 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_5 3767340-3767421 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_6 3920365-3920449 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002928_7 4130977-4131070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_002928_1 1.2|822523|24|NC_002928|PILER-CR 822523-822546 24 NC_002928.3 822385-822408 0 1.0
NC_002928_1 1.2|822523|24|NC_002928|PILER-CR 822523-822546 24 NC_002928.3 822595-822618 0 1.0

1. spacer 1.2|822523|24|NC_002928|PILER-CR matches to position: 822385-822408, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

2. spacer 1.2|822523|24|NC_002928|PILER-CR matches to position: 822595-822618, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3294265 : 3302331 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage