Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_020547 Acinetobacter baumannii D1279779, complete sequence 5 crisprs DEDDh,csa3,cas3,WYL 0 2 4 0
NC_020525 Acinetobacter baumannii D1279779 plasmid pD1279779, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_020547
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020547_1 780215-780291 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020547_2 1487375-1487538 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020547_3 1495441-1495526 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020547_4 1820716-1820840 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020547_5 3003186-3003270 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020547_1 1.1|780241|25|NC_020547|CRISPRCasFinder 780241-780265 25 NZ_CP040048 Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence 572758-572782 3 0.88
NC_020547_4 4.1|1820763|31|NC_020547|CRISPRCasFinder 1820763-1820793 31 NC_028924 Polaribacter phage P12002L, complete genome 39532-39562 8 0.742
NC_020547_4 4.1|1820763|31|NC_020547|CRISPRCasFinder 1820763-1820793 31 NC_028763 Polaribacter phage P12002S, complete genome 39352-39382 8 0.742

1. spacer 1.1|780241|25|NC_020547|CRISPRCasFinder matches to NZ_CP040048 (Acinetobacter baumannii strain VB1190 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

gatgattccagtaatcgggcttaag	CRISPR spacer
gataatgccagtaatcgggcttaaa	Protospacer
***.** *****************.

2. spacer 4.1|1820763|31|NC_020547|CRISPRCasFinder matches to NC_028924 (Polaribacter phage P12002L, complete genome) position: , mismatch: 8, identity: 0.742

gttcgagtggaagaggataaacaaagcaatg	CRISPR spacer
gatgctatggaagagtataaaaaaagcaatt	Protospacer
* *   .******** ***** ******** 

3. spacer 4.1|1820763|31|NC_020547|CRISPRCasFinder matches to NC_028763 (Polaribacter phage P12002S, complete genome) position: , mismatch: 8, identity: 0.742

gttcgagtggaagaggataaacaaagcaatg	CRISPR spacer
gatgctatggaagagtataaaaaaagcaatt	Protospacer
* *   .******** ***** ******** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1107185 : 1150958 62 Acinetobacter_phage(88.24%) transposase,capsid,terminase NA
DBSCAN-SWA_2 1220462 : 1277306 76 Acinetobacter_phage(80.0%) tRNA,capsid,integrase,terminase attL 1226586:1226606|attR 1274585:1274605
DBSCAN-SWA_3 2194873 : 2257410 54 Enterobacteria_phage(30.0%) transposase,holin,coat NA
DBSCAN-SWA_4 2540608 : 2555405 10 Acinetobacter_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage