Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017371 Helicobacter pylori Gambia94/24, complete genome 2 crisprs DEDDh 0 2 1 0
NC_017364 Helicobacter pylori Gambia94/24 plasmid, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_017371
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017371_1 565683-565762 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017371_2 965771-965970 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017371_2 2.3|965917|25|NC_017371|CRT 965917-965941 25 MT741944 Acinetobacter phage vB_AbaP_APK81, complete genome 9820-9844 2 0.92
NC_017371_2 2.2|965860|28|NC_017371|CRT 965860-965887 28 MK448589 Streptococcus satellite phage Javan632, complete genome 4594-4621 5 0.821

1. spacer 2.3|965917|25|NC_017371|CRT matches to MT741944 (Acinetobacter phage vB_AbaP_APK81, complete genome) position: , mismatch: 2, identity: 0.92

acagcgtaagctttaataataacac	CRISPR spacer
acagtgtaagctttagtaataacac	Protospacer
****.**********.*********

2. spacer 2.2|965860|28|NC_017371|CRT matches to MK448589 (Streptococcus satellite phage Javan632, complete genome) position: , mismatch: 5, identity: 0.821

-gtgcccaatccacttttgaaaacagcag	CRISPR spacer
cgta-ccaatcgccttttgaaaacagcaa	Protospacer
 **. ******  ***************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 203559 : 219928 24 Helicobacter_phage(91.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage