Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP020947 Rhizobium sp. CIAT894 chromosome, complete genome 1 crisprs WYL,csa3,cas3,DEDDh 0 1 4 0
NZ_CP020949 Rhizobium sp. CIAT894 plasmid pRheCIAT894b, complete sequence 0 crisprs RT 0 0 0 0
NZ_CP020948 Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 0 crisprs RT 0 0 1 0
NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 0 crisprs csa3,WYL 0 0 64 0
NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 0 crisprs WYL,csa3,DEDDh 0 0 0 0

Results visualization

1. NZ_CP020947
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP020947_1 1374288-1374369 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 565934-565963 3 0.9
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 102047-102076 4 0.867
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 97289-97318 4 0.867
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 389435-389464 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP021026 Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence 85-114 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013597 Rhizobium sp. N741 plasmid pRspN741b, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013501 Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 486569-486598 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013507 Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013518 Rhizobium sp. N113 plasmid pRspN113a, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 103-132 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013491 Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013513 Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013496 Rhizobium sp. N621 plasmid pRspN621a, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013591 Rhizobium sp. N871 plasmid pRspN871a, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013603 Rhizobium sp. N731 plasmid pRspN731b, complete sequence 6-35 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 706466-706495 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1988936-1988965 5 0.833
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 791945-791974 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NC_007762 Rhizobium etli CFN 42 plasmid p42a, complete sequence 44570-44599 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NC_011371 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence 146080-146109 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 908330-908359 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 54390-54419 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 275268-275297 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 287697-287726 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 680357-680386 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 837681-837710 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 635747-635776 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 849421-849450 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 104993-105022 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 307428-307457 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 307427-307456 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 287486-287515 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 160189-160218 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 495319-495348 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 76-105 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 103-132 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 594233-594262 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 24352-24381 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 575331-575360 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 241898-241927 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 551833-551862 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 239606-239635 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1052720-1052749 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 551835-551864 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 53831-53860 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 476257-476286 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 212857-212886 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 473168-473197 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 72171-72200 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 1211765-1211794 6 0.8
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 435129-435158 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 55998-56027 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 349359-349388 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 516782-516811 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 55776-55805 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 288634-288663 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP049248 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence 115958-115987 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 485247-485276 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 472925-472954 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 176475-176504 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 501969-501998 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 461100-461129 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 643876-643905 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 401201-401230 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 709944-709973 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 459884-459913 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 687056-687085 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 614263-614292 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 474683-474712 7 0.767
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 86531-86560 8 0.733
NZ_CP020947_1 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder 1374314-1374343 30 NZ_CP021373 Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence 247628-247657 8 0.733

1. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 3, identity: 0.9

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaccgacatgcgcaa	Protospacer
. *************************** 

2. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.867

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgcaa	Protospacer
. *************** *********** 

3. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.867

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgcaa	Protospacer
. *************** *********** 

4. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

5. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

6. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

7. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

8. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

9. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

10. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

11. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

12. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

13. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

14. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

15. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

16. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

17. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

18. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgcaa	Protospacer
. ************.** *********** 

19. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

20. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

21. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

22. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

23. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

24. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

25. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

26. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

27. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

28. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtaa	Protospacer
. *************** *********.* 

29. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgcaa	Protospacer
. ************.** *********** 

30. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 6, identity: 0.8

-agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
ctgtgc-gttttgcgacaacgacatgcgcag	Protospacer
  * ** ********.** *********** 

31. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtta	Protospacer
. *************** *********.  

32. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gtagcggttttgcggcaacgacatgcgtca	Protospacer
. *************** *********.  

33. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgcga	Protospacer
. ************.** **********. 

34. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgtga	Protospacer
. *************** *********.. 

35. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgaga	Protospacer
. *************** ********* . 

36. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgcgaga	Protospacer
. *************** ********* . 

37. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

38. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgcga	Protospacer
. ************.** **********. 

39. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgtcatgcgtaa	Protospacer
. *************** ** ******.* 

40. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtag	Protospacer
. ************.** *********.* 

41. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgcta	Protospacer
. ************.** **********  

42. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgaaa	Protospacer
. ************.** ********* * 

43. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgaaa	Protospacer
. ************.** ********* * 

44. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

45. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

46. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gaagcgcttttgcggcaacgacatgcgaaa	Protospacer
..**** ********** ********* * 

47. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgctgcaacgacatgcgtaa	Protospacer
. *********** *** *********.* 

48. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacatgggtaa	Protospacer
. *************** ******* *.* 

49. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggtaacgacatgcggaa	Protospacer
. *************.* ********* * 

50. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcggaa	Protospacer
. ************.** ********* * 

51. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

52. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacggcatgcgtaa	Protospacer
. *************** **.******.* 

53. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

54. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacggcatgcgtaa	Protospacer
. *************** **.******.* 

55. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggtagcgacatgcggaa	Protospacer
. *************.* ********* * 

56. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

57. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacggcatgcgtaa	Protospacer
. *************** **.******.* 

58. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggtagcgacatgcggaa	Protospacer
. *************.* ********* * 

59. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacggcatgcgtaa	Protospacer
. *************** **.******.* 

60. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtaa	Protospacer
. ************.** *********.* 

61. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 6, identity: 0.8

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggtagcgacatgcggaa	Protospacer
. *************.* ********* * 

62. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

-agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
ctgtgc-gttttgcgacaacgacatgcgcag	Protospacer
  * ** ********.** *********** 

63. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcggcaacgacatgcgtga	Protospacer
.  ************** *********.. 

64. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtga	Protospacer
. ************.** *********.. 

65. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtta	Protospacer
. ************.** *********.  

66. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gctgcggttttgcgacaacgacatgcgtaa	Protospacer
.  ***********.** *********.* 

67. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgcgtga	Protospacer
. ************.** *********.. 

68. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggcaacgacgtgcgaga	Protospacer
. *************** ****.**** . 

69. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcagcggttttgcggtaacgacatgcggtg	Protospacer
. *************.* *********   

70. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcggcggttttgcgacaacgacatgcgtaa	Protospacer
. .***********.** *********.* 

71. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcggcggttttgcgacaacgacatgcgtaa	Protospacer
. .***********.** *********.* 

72. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcgacaacgacatgcgtaa	Protospacer
.  ***********.** *********.* 

73. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcggcggttttgcgacaacgacatgcgtaa	Protospacer
. .***********.** *********.* 

74. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcgacaacgacatgcgtaa	Protospacer
.  ***********.** *********.* 

75. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcgataccgacatgcgtaa	Protospacer
.  ***********..***********.* 

76. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcgacaacgacatgcgtaa	Protospacer
.  ***********.** *********.* 

77. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gctgcggttttgcggtaacgacatgcgatc	Protospacer
.  ************.* *********  *

78. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gccgcggttttgcgacaacgacatgcgtaa	Protospacer
.  ***********.** *********.* 

79. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

agagcggttttgcggcaccgacatg-cgcac	CRISPR spacer
gcagcggttttgcgacaacgacatgttgta-	Protospacer
. ************.** ******* .*.* 

80. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

--agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcgcaacga--ttgcggcaccgtcatgcgcac	Protospacer
  . *.**.  *********** *********

81. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.767

--agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gcgcaacga--ttgcggcaccgtcatgcgcac	Protospacer
  . *.**.  *********** *********

82. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 8, identity: 0.733

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gctgcggttttgcggtaacgacatgcataa	Protospacer
.  ************.* ********..* 

83. spacer 1.1|1374314|30|NZ_CP020947|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 8, identity: 0.733

agagcggttttgcggcaccgacatgcgcac	CRISPR spacer
gtagcggttttgcggtaacgacatgtgaga	Protospacer
. *************.* *******.* . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1045614 : 1101214 55 Stx2-converting_phage(10.0%) capsid,transposase,terminase NA
DBSCAN-SWA_2 1499797 : 1508954 9 Aeromonas_phage(14.29%) NA NA
DBSCAN-SWA_3 1910611 : 1919746 10 uncultured_Mediterranean_phage(88.89%) tRNA NA
DBSCAN-SWA_4 3930182 : 3940597 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP020948
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 146886 : 155977 9 Planktothrix_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP020950
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 257690 : 311819 23 Enterobacteria_phage(100.0%) plate,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP020952
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 6596 6 Ostreococcus_lucimarinus_virus(100.0%) NA NA
DBSCAN-SWA_2 15087 : 20739 5 Ectocarpus_siliculosus_virus(33.33%) NA NA
DBSCAN-SWA_3 31671 : 43379 8 Orpheovirus(25.0%) transposase NA
DBSCAN-SWA_4 48707 : 51092 3 Vibrio_phage(50.0%) NA NA
DBSCAN-SWA_5 63514 : 65618 2 Tupanvirus(50.0%) NA NA
DBSCAN-SWA_6 69686 : 73690 4 Bathycoccus_sp._RCC1105_virus(33.33%) NA NA
DBSCAN-SWA_7 84947 : 85697 1 Trichoplusia_ni_ascovirus(100.0%) NA NA
DBSCAN-SWA_8 94053 : 96198 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_9 99337 : 104624 4 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_10 112302 : 113115 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_11 123179 : 124307 1 Synechococcus_phage(100.0%) NA NA
DBSCAN-SWA_12 127623 : 129219 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_13 132489 : 136886 6 Staphylococcus_phage(33.33%) NA NA
DBSCAN-SWA_14 145378 : 148020 2 Rhodococcus_phage(50.0%) NA NA
DBSCAN-SWA_15 154146 : 163000 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_16 167451 : 171219 5 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_17 179668 : 180346 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_18 183903 : 186524 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_19 193344 : 197796 5 uncultured_virus(50.0%) NA NA
DBSCAN-SWA_20 208641 : 210144 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_21 214931 : 215693 1 Chrysochromulina_ericina_virus(100.0%) NA NA
DBSCAN-SWA_22 225450 : 227025 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_23 244879 : 249134 3 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_24 253728 : 255534 1 Micromonas_sp._RCC1109_virus(100.0%) NA NA
DBSCAN-SWA_25 261661 : 265207 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_26 273796 : 274585 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_27 280795 : 286762 5 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_28 289996 : 295283 5 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_29 307264 : 309082 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_30 315059 : 330753 12 Ochrobactrum_phage(28.57%) NA NA
DBSCAN-SWA_31 335975 : 336806 1 Klosneuvirus(100.0%) NA NA
DBSCAN-SWA_32 343210 : 349519 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_33 359158 : 361663 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_34 374350 : 382957 4 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_35 386135 : 390331 4 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_36 402971 : 404852 1 uncultured_Caudovirales_phage(100.0%) NA NA
DBSCAN-SWA_37 407853 : 410925 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_38 413982 : 415023 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_39 419744 : 420851 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_40 432832 : 438310 5 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_41 447518 : 451554 4 Bacillus_virus(33.33%) NA NA
DBSCAN-SWA_42 459184 : 460294 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_43 465179 : 465599 1 uncultured_marine_virus(100.0%) NA NA
DBSCAN-SWA_44 472311 : 478635 6 Escherichia_phage(75.0%) NA NA
DBSCAN-SWA_45 483564 : 485220 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_46 495940 : 501190 2 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_47 509767 : 513097 3 Burkholderia_virus(50.0%) NA NA
DBSCAN-SWA_48 518359 : 519451 1 Planktothrix_phage(100.0%) NA NA
DBSCAN-SWA_49 526741 : 527869 1 Prochlorococcus_phage(100.0%) NA NA
DBSCAN-SWA_50 536817 : 537900 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_51 543062 : 547724 4 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_52 551820 : 552888 1 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_53 559569 : 566576 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_54 587422 : 591726 5 Moraxella_phage(33.33%) NA NA
DBSCAN-SWA_55 596780 : 597532 1 Paenibacillus_phage(100.0%) transposase NA
DBSCAN-SWA_56 604972 : 606450 2 Planktothrix_phage(50.0%) NA NA
DBSCAN-SWA_57 611028 : 613287 1 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_58 616487 : 622086 3 Bacillus_virus(100.0%) NA NA
DBSCAN-SWA_59 633961 : 638158 3 Mycobacterium_phage(50.0%) NA NA
DBSCAN-SWA_60 650353 : 651388 1 Megavirus(100.0%) NA NA
DBSCAN-SWA_61 659130 : 667429 4 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_62 677968 : 683900 3 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_63 691086 : 691881 1 Organic_Lake_phycodnavirus(100.0%) NA NA
DBSCAN-SWA_64 713281 : 718394 4 Ochrobactrum_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage