Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP021126 Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
NZ_CP021124 Rhizobium sp. Kim5 chromosome, complete genome 2 crisprs WYL,csa3,cas3,DEDDh 0 1 7 0
NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 0 crisprs csa3 0 0 0 0
NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 0 crisprs NA 0 0 2 0
NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NZ_CP021124
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021124_1 2069840-2069932 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP021124_2 2070194-2070270 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_LR723672 Rhizobium flavum strain YW14 plasmid 3 117273-117303 5 0.839
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP039905 Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence 171034-171064 5 0.839
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP039909 Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence 110882-110912 5 0.839
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_LS974446 Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence 10027-10057 5 0.839
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 734894-734924 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 350211-350241 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 597559-597589 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 455773-455803 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 756251-756281 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1460821-1460851 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 232935-232965 8 0.742
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP010856 Marinovum algicola DG 898 plasmid pMaD1, complete sequence 216682-216712 9 0.71
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 MG925349 Mycobacterium phage Mendokysei, complete genome 20937-20967 9 0.71
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 7423-7453 9 0.71
NZ_CP021124_2 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder 2070217-2070247 31 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 554325-554355 9 0.71

1. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 5, identity: 0.839

gcggccaggccggcatcaagggccat-gtgac	CRISPR spacer
gcggcctcgccggcatcaagggcaacagtga-	Protospacer
******  *************** *. **** 

2. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP039905 (Agrobacterium tumefaciens strain CFBP6623 plasmid pAtCFBP6623a, complete sequence) position: , mismatch: 5, identity: 0.839

gcggccaggccggcatcaagggccat-gtgac	CRISPR spacer
gcggcctcgccggcatcaagggcaacagtga-	Protospacer
******  *************** *. **** 

3. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP039909 (Agrobacterium tumefaciens strain CFBP6624 plasmid pAtCFBP6624, complete sequence) position: , mismatch: 5, identity: 0.839

gcggccaggccggcatcaagggccat-gtgac	CRISPR spacer
gcggcctcgccggcatcaagggcaacagtga-	Protospacer
******  *************** *. **** 

4. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_LS974446 (Rhizobium selenitireducens ATCC BAA-1503 isolate T2.30D-1.1_plasmid plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.839

gcggccaggccggcatcaagggccat-gtgac	CRISPR spacer
gcggcctcgccggcatcaagggcaacagtga-	Protospacer
******  *************** *. **** 

5. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
tcgaggcggccggcatcaaggcccatgtgtg	Protospacer
 **.   ************** *******  

6. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
gaggccaggcgggcagcaagggccacggcct	Protospacer
* ******** **** *********.*   .

7. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
gaggccaggcgggcagcaagggccacggcct	Protospacer
* ******** **** *********.*   .

8. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
tcgagaaggccggcatcaaagcccatgtgtg	Protospacer
 **.  *************.* *******  

9. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
gaaacggcgccgacatcaagggccgtgtgac	Protospacer
* ..* . ****.***********.******

10. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
gaaacggcgccgacatcaagggccgtgtgac	Protospacer
* ..* . ****.***********.******

11. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
gcggccagcacggcatcaagggcttcacgaa	Protospacer
********  *************. ...** 

12. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 9, identity: 0.71

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
tcacacagaccggcatcaagggccatggtcg	Protospacer
 *.  ***.******************    

13. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 9, identity: 0.71

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
ccggccaggccggcagcaagggcggcgacgg	Protospacer
 ************** ******* ..*  . 

14. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 9, identity: 0.71

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
ccggcaaggccggcaacaagggcctcttcga	Protospacer
 **** ********* ******** . * . 

15. spacer 2.1|2070217|31|NZ_CP021124|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 9, identity: 0.71

gcggccaggccggcatcaagggccatgtgac	CRISPR spacer
ccggcaaggccggcaacaagggcctcttcga	Protospacer
 **** ********* ******** . * . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1652408 : 1661509 9 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_2 1961190 : 1974241 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_3 2223740 : 2233900 9 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_4 2869038 : 2917791 54 Enterobacteria_phage(25.0%) integrase,transposase attL 2864936:2864952|attR 2916508:2916524
DBSCAN-SWA_5 3155773 : 3164250 8 Rhizobium_phage(50.0%) plate NA
DBSCAN-SWA_6 3168947 : 3193686 35 Ochrobactrum_phage(38.1%) integrase,tail,head,transposase attL 3177583:3177597|attR 3202097:3202111
DBSCAN-SWA_7 4120057 : 4130344 8 Mycobacterium_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP021125
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 231049 : 289994 30 Mannheimia_phage(100.0%) transposase,plate NA
DBSCAN-SWA_2 320939 : 364083 27 Paenibacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage