Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NZ_CP035755 Escherichia coli E110019 extrachromosomal 0 crisprs NA 0 0 1 0
NZ_CP035756 Escherichia coli E110019 plasmid pE110019_5, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP035754 Escherichia coli E110019 plasmid pE110019_33, complete sequence 0 crisprs NA 0 0 0 0
NZ_CP035753 Escherichia coli E110019 plasmid pE110019_65, complete sequence 0 crisprs NA 0 0 1 0
NZ_CP035751 Escherichia coli E110019 chromosome, complete genome 5 crisprs DinG,RT,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 19 18 0
NZ_CP035752 Escherichia coli E110019 plasmid pE110019_66, complete sequence 0 crisprs NA 0 0 5 0

Results visualization

1. NZ_CP035751
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035751_1 513286-513399 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035751_2 2509873-2510018 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035751_3 3617485-3618123 TypeI-E I-E
10 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035751_4 3643822-3644521 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NZ_CP035751_5 4082218-4082613 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NZ_CP035751_1 1.1|513309|24|NZ_CP035751|PILER-CR 513309-513332 24 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37675 0 1.0
NZ_CP035751_1 1.1|513309|24|NZ_CP035751|PILER-CR 513309-513332 24 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37958 0 1.0
NZ_CP035751_1 1.2|513356|25|NZ_CP035751|PILER-CR 513356-513380 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37628 0 1.0
NZ_CP035751_1 1.2|513356|25|NZ_CP035751|PILER-CR 513356-513380 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37911 0 1.0
NZ_CP035751_1 1.1|513309|24|NZ_CP035751|PILER-CR 513309-513332 24 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44595 1 0.958
NZ_CP035751_1 1.2|513356|25|NZ_CP035751|PILER-CR 513356-513380 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44548 1 0.96
NZ_CP035751_3 3.1|3617514|32|NZ_CP035751|CRT 3617514-3617545 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
NZ_CP035751_1 1.2|513356|25|NZ_CP035751|PILER-CR 513356-513380 25 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35685 4 0.84
NZ_CP035751_3 3.1|3617514|32|NZ_CP035751|CRT 3617514-3617545 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
NZ_CP035751_3 3.6|3617819|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617819-3617850 32 MG592395 Vibrio phage 1.009.O._10N.261.51.C9, partial genome 40497-40528 7 0.781
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_CP014675 Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence 7195-7226 7 0.781
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_LT900339 Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2 150796-150827 7 0.781
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NC_006672 Gluconobacter oxydans 621H plasmid pGOX1, complete sequence 150793-150824 7 0.781
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_CP015167 Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence 42266-42297 7 0.781
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_CP043044 Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence 108578-108609 7 0.781
NZ_CP035751_4 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT 3643851-3643882 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
NZ_CP035751_3 3.1|3617514|32|NZ_CP035751|CRT 3617514-3617545 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
NZ_CP035751_4 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT 3643851-3643882 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 284992-285023 8 0.75
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 AB897757 Klebsiella phage K64-1 DNA, complete genome 284799-284830 8 0.75
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 222831-222862 8 0.75
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 KC821619 Cellulophaga phage phi18:1, complete genome 23646-23677 8 0.75
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 KC821627 Cellulophaga phage phi18:2, complete genome 22933-22964 8 0.75
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 NC_019526 Enterobacteria phage vB_KleM-RaK2, complete genome 284992-285023 8 0.75
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 AB897757 Klebsiella phage K64-1 DNA, complete genome 284799-284830 8 0.75
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 222831-222862 8 0.75
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 KC821619 Cellulophaga phage phi18:1, complete genome 23646-23677 8 0.75
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 KC821627 Cellulophaga phage phi18:2, complete genome 22933-22964 8 0.75
NZ_CP035751_3 3.1|3617514|32|NZ_CP035751|CRT 3617514-3617545 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065682 UNVERIFIED: Campylobacter phage A112b, complete genome 28803-28834 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 LN881735 Escherichia phage slur12, complete genome 99901-99932 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065659 UNVERIFIED: Campylobacter phage C5, complete genome 72598-72629 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 LR597647 Escherichia phage rV5_ev147 genome assembly, chromosome: 1 7892-7923 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065661 UNVERIFIED: Campylobacter phage C9, complete genome 87324-87355 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065655 UNVERIFIED: Campylobacter phage C2, complete genome 111970-112001 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850646 Escherichia phage nom, complete genome 6794-6825 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 KR698074 Escherichia phage APCEc02, complete genome 130018-130049 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065666 UNVERIFIED: Campylobacter phage A12a, complete genome 107359-107390 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MK883717 Eschericha phage vB_EcoM-ECP26, complete genome 23242-23273 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 LR694165 Escherichia phage rV5_ev156 genome assembly, chromosome: 1 7892-7923 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG963916 Escherichia phage PDX, complete genome 14456-14487 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 KP869102 Escherichia coli O157 typing phage 4, partial genome 34218-34249 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065658 UNVERIFIED: Campylobacter phage C7, complete genome 7788-7819 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 NC_028248 Escherichia phage slur16, complete genome 41839-41870 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065654 UNVERIFIED: Campylobacter phage C15, complete genome 107386-107417 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850642 Escherichia phage navn, complete genome 125737-125768 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MK883718 Escherichia phage vB_EcoM-ECP32, complete genome 7836-7867 9 0.719
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 22708-22739 9 0.719
NZ_CP035751_3 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617880-3617911 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 134024-134055 9 0.719
NZ_CP035751_3 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617941-3617972 32 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 124162-124193 9 0.719
NZ_CP035751_3 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617941-3617972 32 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 1029435-1029466 9 0.719
NZ_CP035751_3 3.10|3618063|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3618063-3618094 32 NZ_CP039931 Acinetobacter baumannii strain TG29392 plasmid pTG29392_1, complete sequence 45479-45510 9 0.719
NZ_CP035751_4 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT 3643851-3643882 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 NZ_CP038602 Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence 11569-11600 9 0.719
NZ_CP035751_4 4.8|3644278|32|NZ_CP035751|CRISPRCasFinder,CRT 3644278-3644309 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 953691-953722 9 0.719
NZ_CP035751_4 4.8|3644278|32|NZ_CP035751|CRISPRCasFinder,CRT 3644278-3644309 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 540088-540119 9 0.719
NZ_CP035751_4 4.10|3644400|32|NZ_CP035751|CRISPRCasFinder,CRT 3644400-3644431 32 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 122446-122477 9 0.719
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 NZ_CP038602 Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence 11569-11600 9 0.719
NZ_CP035751_4 4.18|3644282|32|NZ_CP035751|PILER-CR 3644282-3644313 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 953691-953722 9 0.719
NZ_CP035751_4 4.18|3644282|32|NZ_CP035751|PILER-CR 3644282-3644313 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 540088-540119 9 0.719
NZ_CP035751_4 4.20|3644404|32|NZ_CP035751|PILER-CR 3644404-3644435 32 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 122446-122477 9 0.719
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065677 UNVERIFIED: Campylobacter phage A13b, complete genome 39950-39981 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 KP869112 Escherichia coli O157 typing phage 14, partial genome 125490-125521 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MK962749 Shigella phage CM1, complete genome 7839-7870 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850597 Escherichia phage isim, complete genome 41361-41392 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850578 Escherichia phage nomo, complete genome 14950-14981 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850626 Escherichia phage nimi, complete genome 75467-75498 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065644 UNVERIFIED: Campylobacter phage A147, complete genome 30845-30876 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850612 Escherichia phage magaca, complete genome 98013-98044 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 LR699804 Escherichia phage rV5_ev146 genome assembly, chromosome: 1 9065-9096 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065647 UNVERIFIED: Campylobacter phage D#, complete genome 90009-90040 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 NC_011041 Escherichia coli bacteriophage rv5, complete sequence 7837-7868 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065646 UNVERIFIED: Campylobacter phage D1, complete genome 122968-122999 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 NC_022323 Escherichia phage 2 JES-2013, complete genome 7837-7868 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065635 UNVERIFIED: Campylobacter phage C12, complete genome 40854-40885 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MH752840 Escherichia phage vB_EcoM-Pr121LW, complete genome 96164-96195 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065674 UNVERIFIED: Campylobacter phage A140, complete genome 6285-6316 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 KP869103 Escherichia coli O157 typing phage 5, complete genome 32688-32719 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MK373780 Escherichia phage vB_EcoM_HdK5, complete genome 39965-39996 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065662 UNVERIFIED: Campylobacter phage A142, complete genome 47401-47432 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MK327930 Escherichia phage EdH4, complete genome 39236-39267 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065672 UNVERIFIED: Campylobacter phage A141, complete genome 58568-58599 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MG065690 UNVERIFIED: Campylobacter phage A135, complete genome 49331-49362 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 KT001917 Escherichia phage Murica, complete genome 7838-7869 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850627 Escherichia phage pangalan, complete genome 132490-132521 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850649 Escherichia phage nomine, complete genome 52411-52442 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850595 Escherichia phage naswa, complete genome 69467-69498 10 0.688
NZ_CP035751_3 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617636-3617667 32 MN850576 Escherichia phage ime, complete genome 88668-88699 10 0.688
NZ_CP035751_3 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder 3617941-3617972 32 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 566483-566514 10 0.688
NZ_CP035751_4 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT 3643851-3643882 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
NZ_CP035751_4 4.3|3643973|32|NZ_CP035751|CRISPRCasFinder,CRT 3643973-3644004 32 AJ278322 Corynebacterium phage BFK20 38417-38448 10 0.688
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 MH511048 Podoviridae sp. isolate ctbh1, complete genome 4054-4085 10 0.688
NZ_CP035751_4 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT 3644034-3644065 32 HM144387 Bacillus phage W.Ph., complete genome 131584-131615 10 0.688
NZ_CP035751_4 4.9|3644339|32|NZ_CP035751|CRISPRCasFinder,CRT 3644339-3644370 32 AJ278322 Corynebacterium phage BFK20 38417-38448 10 0.688
NZ_CP035751_4 4.13|3643977|32|NZ_CP035751|PILER-CR 3643977-3644008 32 AJ278322 Corynebacterium phage BFK20 38417-38448 10 0.688
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 MH511048 Podoviridae sp. isolate ctbh1, complete genome 4054-4085 10 0.688
NZ_CP035751_4 4.14|3644038|32|NZ_CP035751|PILER-CR 3644038-3644069 32 HM144387 Bacillus phage W.Ph., complete genome 131584-131615 10 0.688
NZ_CP035751_4 4.19|3644343|32|NZ_CP035751|PILER-CR 3644343-3644374 32 AJ278322 Corynebacterium phage BFK20 38417-38448 10 0.688

1. spacer 1.1|513309|24|NZ_CP035751|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

2. spacer 1.1|513309|24|NZ_CP035751|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

cgcctttacctgatttgggtaaac	CRISPR spacer
cgcctttacctgatttgggtaaac	Protospacer
************************

3. spacer 1.2|513356|25|NZ_CP035751|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

4. spacer 1.2|513356|25|NZ_CP035751|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttcaggtaaactttat	Protospacer
*************************

5. spacer 1.1|513309|24|NZ_CP035751|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958

cgcctttacctgatttgggtaaac	CRISPR spacer
tgcctttacctgatttgggtaaac	Protospacer
.***********************

6. spacer 1.2|513356|25|NZ_CP035751|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96

tttacctctttcaggtaaactttat	CRISPR spacer
tttacctctttaaggtaaactttat	Protospacer
*********** *************

7. spacer 3.1|3617514|32|NZ_CP035751|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

8. spacer 1.2|513356|25|NZ_CP035751|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

tttacctctttcaggtaaactttat	CRISPR spacer
ggtatctcattcaggtaaactttat	Protospacer
  **.*** ****************

9. spacer 3.1|3617514|32|NZ_CP035751|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

10. spacer 3.6|3617819|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG592395 (Vibrio phage 1.009.O._10N.261.51.C9, partial genome) position: , mismatch: 7, identity: 0.781

tgctggcgcatcactggccgcaggtcaaaaac	CRISPR spacer
tactggcgcaccactggccgcatgtgcctaac	Protospacer
*.********.*********** **    ***

11. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tcgcatgaacgggcgcgtctgtggtgggacta	Protospacer
*****************. *****.  ** * 

12. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT900339 (Gluconobacter oxydans 621H isolate WT-DSMZ plasmid 2) position: , mismatch: 7, identity: 0.781

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tcgcatgaacgggcgcgtctgtggtgggacta	Protospacer
*****************. *****.  ** * 

13. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NC_006672 (Gluconobacter oxydans 621H plasmid pGOX1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tcgcatgaacgggcgcgtctgtggtgggacta	Protospacer
*****************. *****.  ** * 

14. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015167 (Acetobacter ascendens strain LMG 1590 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tcgcatgaacgggcgcgtctgtggtgggacta	Protospacer
*****************. *****.  ** * 

15. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043044 (Gluconobacter thailandicus strain HD924 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tcgcatgaacgggcgcgtctgtggtgggacta	Protospacer
*****************. *****.  ** * 

16. spacer 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

17. spacer 3.1|3617514|32|NZ_CP035751|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

18. spacer 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

19. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ttagaaagctgattaaagtatccatagtatga	Protospacer
*.********.**********.****  *   

20. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ttagaaagctgattaaagtatccatagtacga	Protospacer
*.********.**********.****  *   

21. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ccagaaagcaatttaaagtattcaaaattacc	Protospacer
.******** * ************ *   *.*

22. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
atatacaactaatcaaaatattcatataaatg	Protospacer
 .* * *.*****.***.************* 

23. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
atatacaactaatcaaaatattcatataaatg	Protospacer
 .* * *.*****.***.************* 

24. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to NC_019526 (Enterobacteria phage vB_KleM-RaK2, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ttagaaagctgattaaagtatccatagtatga	Protospacer
*.********.**********.****  *   

25. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to AB897757 (Klebsiella phage K64-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ttagaaagctgattaaagtatccatagtacga	Protospacer
*.********.**********.****  *   

26. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
ccagaaagcaatttaaagtattcaaaattacc	Protospacer
.******** * ************ *   *.*

27. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
atatacaactaatcaaaatattcatataaatg	Protospacer
 .* * *.*****.***.************* 

28. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 8, identity: 0.75

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
atatacaactaatcaaaatattcatataaatg	Protospacer
 .* * *.*****.***.************* 

29. spacer 3.1|3617514|32|NZ_CP035751|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

30. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065682 (UNVERIFIED: Campylobacter phage A112b, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

31. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to LN881735 (Escherichia phage slur12, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

32. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065659 (UNVERIFIED: Campylobacter phage C5, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

33. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to LR597647 (Escherichia phage rV5_ev147 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

34. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065661 (UNVERIFIED: Campylobacter phage C9, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

35. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065655 (UNVERIFIED: Campylobacter phage C2, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

36. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850646 (Escherichia phage nom, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

37. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to KR698074 (Escherichia phage APCEc02, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

38. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065666 (UNVERIFIED: Campylobacter phage A12a, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

39. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MK883717 (Eschericha phage vB_EcoM-ECP26, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgtt	Protospacer
 . .* ******* ********** *****  

40. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to LR694165 (Escherichia phage rV5_ev156 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

41. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG963916 (Escherichia phage PDX, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

42. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to KP869102 (Escherichia coli O157 typing phage 4, partial genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

43. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065658 (UNVERIFIED: Campylobacter phage C7, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

44. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NC_028248 (Escherichia phage slur16, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

45. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065654 (UNVERIFIED: Campylobacter phage C15, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

46. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850642 (Escherichia phage navn, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

47. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MK883718 (Escherichia phage vB_EcoM-ECP32, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgtt	Protospacer
 . .* ******* ********** *****  

48. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tgccatgaaggggcgcgcgcgtggccgaacgc	Protospacer
*  ****** *********.****** .*  .

49. spacer 3.7|3617880|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgcatgaacgggcgcgcgtgtggcccgaatt	CRISPR spacer
tgccatgaaggggcgcgcgcgtggccgaacgc	Protospacer
*  ****** *********.****** .*  .

50. spacer 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggcggattcaatctggccaatatcgacga	CRISPR spacer
gcgggcggcttcaatccggccaaccgcacctg	Protospacer
******** *******.******.  *. * .

51. spacer 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 9, identity: 0.719

gcgggcggattcaatctggccaata--tcgacga	CRISPR spacer
cagggcgaattgaatctggccaataagccaat--	Protospacer
  *****.*** *************  .*.*.  

52. spacer 3.10|3618063|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039931 (Acinetobacter baumannii strain TG29392 plasmid pTG29392_1, complete sequence) position: , mismatch: 9, identity: 0.719

gggtaaaggcattgttttagccctgaacccgc	CRISPR spacer
gagcaaaggcattggttaagccctgaaaaatt	Protospacer
*.*.********** ** *********    .

53. spacer 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

54. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP038602 (Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
gaccaaagctaaataaagtattaatatcaggc	Protospacer
    ******** ********* **** *. *

55. spacer 4.8|3644278|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.719

gccattgggccgggatttctgagaagtttcgc	CRISPR spacer
ggcattgggccgggattgccgagaagcgggag	Protospacer
* *************** *.******.   . 

56. spacer 4.8|3644278|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719

gccattgggccgggatttctgagaagtttcgc	CRISPR spacer
ggcattgggccgggattgccgagaagcgggag	Protospacer
* *************** *.******.   . 

57. spacer 4.10|3644400|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagaagctccactggcaaaaagccaaaac	CRISPR spacer
gggatgaagctccactggccgaaagccacctc	Protospacer
. *  ************** .*******   *

58. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to NZ_CP038602 (Salmonella enterica subsp. enterica serovar Senftenberg strain 11-5006 plasmid p11-5006.1, complete sequence) position: , mismatch: 9, identity: 0.719

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
gaccaaagctaaataaagtattaatatcaggc	Protospacer
    ******** ********* **** *. *

59. spacer 4.18|3644282|32|NZ_CP035751|PILER-CR matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.719

gccattgggccgggatttctgagaagtttcgc	CRISPR spacer
ggcattgggccgggattgccgagaagcgggag	Protospacer
* *************** *.******.   . 

60. spacer 4.18|3644282|32|NZ_CP035751|PILER-CR matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719

gccattgggccgggatttctgagaagtttcgc	CRISPR spacer
ggcattgggccgggattgccgagaagcgggag	Protospacer
* *************** *.******.   . 

61. spacer 4.20|3644404|32|NZ_CP035751|PILER-CR matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 9, identity: 0.719

atgcagaagctccactggcaaaaagccaaaac	CRISPR spacer
gggatgaagctccactggccgaaagccacctc	Protospacer
. *  ************** .*******   *

62. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065677 (UNVERIFIED: Campylobacter phage A13b, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

63. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to KP869112 (Escherichia coli O157 typing phage 14, partial genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

64. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MK962749 (Shigella phage CM1, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

65. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850597 (Escherichia phage isim, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

66. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850578 (Escherichia phage nomo, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

67. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850626 (Escherichia phage nimi, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

68. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065644 (UNVERIFIED: Campylobacter phage A147, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

69. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850612 (Escherichia phage magaca, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

70. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to LR699804 (Escherichia phage rV5_ev146 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

71. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065647 (UNVERIFIED: Campylobacter phage D#, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

72. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NC_011041 (Escherichia coli bacteriophage rv5, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

73. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065646 (UNVERIFIED: Campylobacter phage D1, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

74. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NC_022323 (Escherichia phage 2 JES-2013, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

75. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065635 (UNVERIFIED: Campylobacter phage C12, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

76. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MH752840 (Escherichia phage vB_EcoM-Pr121LW, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

77. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065674 (UNVERIFIED: Campylobacter phage A140, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

78. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to KP869103 (Escherichia coli O157 typing phage 5, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

79. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MK373780 (Escherichia phage vB_EcoM_HdK5, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

80. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065662 (UNVERIFIED: Campylobacter phage A142, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

81. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MK327930 (Escherichia phage EdH4, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

82. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065672 (UNVERIFIED: Campylobacter phage A141, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

83. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MG065690 (UNVERIFIED: Campylobacter phage A135, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

84. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to KT001917 (Escherichia phage Murica, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

85. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850627 (Escherichia phage pangalan, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

86. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850649 (Escherichia phage nomine, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

87. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850595 (Escherichia phage naswa, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

88. spacer 3.3|3617636|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to MN850576 (Escherichia phage ime, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

89. spacer 3.8|3617941|32|NZ_CP035751|CRT,PILER-CR,CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 10, identity: 0.688

gcgggcggattcaatctggccaatatcgacga	CRISPR spacer
caacacggcttcaatctggccgatatcgtgaa	Protospacer
  . .*** ************.******  .*

90. spacer 4.1|3643851|32|NZ_CP035751|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******    

91. spacer 4.3|3643973|32|NZ_CP035751|CRISPRCasFinder,CRT matches to AJ278322 (Corynebacterium phage BFK20) position: , mismatch: 10, identity: 0.688

caactgacgtccgatattggcatggctggcaa	CRISPR spacer
gaggtgacgtacgatattgccatggctacggc	Protospacer
 *. ****** ******** *******.  . 

92. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to MH511048 (Podoviridae sp. isolate ctbh1, complete genome) position: , mismatch: 10, identity: 0.688

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
tgcccaagctaatcaaagtattcacatactgt	Protospacer
*    ********.**********.***   .

93. spacer 4.4|3644034|32|NZ_CP035751|CRISPRCasFinder,CRT matches to HM144387 (Bacillus phage W.Ph., complete genome) position: , mismatch: 10, identity: 0.688

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
aattaaaactaattaaactattcatattatca	Protospacer
    ***.********* ********* * . 

94. spacer 4.9|3644339|32|NZ_CP035751|CRISPRCasFinder,CRT matches to AJ278322 (Corynebacterium phage BFK20) position: , mismatch: 10, identity: 0.688

caactgacgtccgatattggcatggctggcaa	CRISPR spacer
gaggtgacgtacgatattgccatggctacggc	Protospacer
 *. ****** ******** *******.  . 

95. spacer 4.13|3643977|32|NZ_CP035751|PILER-CR matches to AJ278322 (Corynebacterium phage BFK20) position: , mismatch: 10, identity: 0.688

caactgacgtccgatattggcatggctggcaa	CRISPR spacer
gaggtgacgtacgatattgccatggctacggc	Protospacer
 *. ****** ******** *******.  . 

96. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to MH511048 (Podoviridae sp. isolate ctbh1, complete genome) position: , mismatch: 10, identity: 0.688

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
tgcccaagctaatcaaagtattcacatactgt	Protospacer
*    ********.**********.***   .

97. spacer 4.14|3644038|32|NZ_CP035751|PILER-CR matches to HM144387 (Bacillus phage W.Ph., complete genome) position: , mismatch: 10, identity: 0.688

tcagaaagctaattaaagtattcatataaatc	CRISPR spacer
aattaaaactaattaaactattcatattatca	Protospacer
    ***.********* ********* * . 

98. spacer 4.19|3644343|32|NZ_CP035751|PILER-CR matches to AJ278322 (Corynebacterium phage BFK20) position: , mismatch: 10, identity: 0.688

caactgacgtccgatattggcatggctggcaa	CRISPR spacer
gaggtgacgtacgatattgccatggctacggc	Protospacer
 *. ****** ******** *******.  . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 69799 : 79173 7 Klebsiella_phage(16.67%) transposase NA
DBSCAN-SWA_2 400911 : 521115 111 Enterobacteria_phage(40.68%) transposase,tail,capsid,tRNA,head,portal,protease,plate,terminase,integrase attL 445793:445808|attR 528440:528455
DBSCAN-SWA_3 738424 : 802502 51 Stx2-converting_phage(21.43%) transposase,protease,holin NA
DBSCAN-SWA_4 1021294 : 1082804 77 Stx2-converting_phage(33.78%) transposase,capsid,tail,head,protease,terminase,holin,integrase attL 1009189:1009207|attR 1045353:1045371
DBSCAN-SWA_5 1290256 : 1357593 80 Enterobacteria_phage(40.82%) tail,portal,head,capsid,protease,terminase,holin,integrase attL 1305338:1305397|attR 1352856:1352920
DBSCAN-SWA_6 1583650 : 1599574 18 Enterobacteria_phage(64.29%) transposase,integrase attL 1583914:1583927|attR 1593943:1593956
DBSCAN-SWA_7 1622985 : 1698345 94 Enterobacteria_phage(20.9%) transposase,lysis,capsid,tail,head,portal,tRNA,protease,terminase,holin,integrase attL 1649771:1649791|attR 1685327:1685347
DBSCAN-SWA_8 2003357 : 2192292 167 Enterobacteria_phage(32.43%) transposase,portal,tail,protease,terminase NA
DBSCAN-SWA_9 2203756 : 2263745 59 uncultured_Caudovirales_phage(71.43%) portal,capsid,head,tRNA,protease,terminase,integrase attL 2209340:2209355|attR 2231742:2231757
DBSCAN-SWA_10 2337287 : 2354444 20 Enterobacteria_phage(80.0%) transposase,plate,tail NA
DBSCAN-SWA_11 2611688 : 2663053 59 Enterobacteria_phage(33.33%) transposase,tail,capsid,head,terminase,holin,integrase attL 2648984:2649000|attR 2681236:2681252
DBSCAN-SWA_12 2721906 : 2726781 6 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_13 2733378 : 2739994 11 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_14 2821040 : 2926498 114 Enterobacteria_phage(32.53%) transposase,tail,capsid,head,tRNA,protease,terminase,holin,integrase attL 2869273:2869293|attR 2924013:2924033
DBSCAN-SWA_15 3127683 : 3174325 53 Enterobacteria_phage(80.95%) capsid,portal,tRNA,head,tail,plate,terminase,integrase attL 3123845:3123868|attR 3170874:3170897
DBSCAN-SWA_16 3422362 : 3514204 92 Enterobacteria_phage(33.33%) transposase,lysis,tail,capsid,head,tRNA,terminase,holin NA
DBSCAN-SWA_17 3594049 : 3601189 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_18 4699012 : 4707200 9 Stx2-converting_phage(85.71%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NZ_CP035755
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1225 : 19244 22 Enterobacteria_phage(95.45%) plate,tail,holin,capsid,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NZ_CP035753
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 46514 : 52568 6 Stx2-converting_phage(50.0%) transposase,integrase attL 44903:44962|attR 61169:61235
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NZ_CP035752
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 8009 11 Xanthomonas_phage(33.33%) NA NA
DBSCAN-SWA_2 15953 : 16175 1 Vibrio_virus(100.0%) NA NA
DBSCAN-SWA_3 38917 : 41332 4 Xanthomonas_phage(50.0%) NA NA
DBSCAN-SWA_4 47071 : 47776 1 Escherichia_phage(100.0%) transposase NA
DBSCAN-SWA_5 58211 : 60376 3 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage