Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014644 Gardnerella vaginalis ATCC 14019, complete sequence 4 crisprs cse2gr11,cas7,cas5,cas6e,cas1,DEDDh,cas3,WYL,PD-DExK 0 20 1 0

Results visualization

1. NC_014644
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014644_1 418194-418331 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014644_2 836407-838265 TypeI-E I-C,I-E,II-B
30 spacers
DEDDh,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014644_3 1124196-1124273 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014644_4 1470299-1470405 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014644_2 2.12|837113|33|NC_014644|PILER-CR 837113-837145 33 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 189674-189706 6 0.818
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 NC_041878 Pectobacterium phage CBB, complete genome 294908-294940 6 0.818
NC_014644_2 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT 837107-837139 33 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 189674-189706 6 0.818
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 NC_041878 Pectobacterium phage CBB, complete genome 294908-294940 6 0.818
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 95503-95535 7 0.788
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 95503-95535 7 0.788
NC_014644_3 3.1|1124220|30|NC_014644|CRISPRCasFinder 1124220-1124249 30 NZ_CP049914 Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence 537966-537995 7 0.767
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 30355-30387 8 0.758
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 NZ_CP044261 Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence 29040-29072 8 0.758
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 NC_012040 Campylobacter lari RM2100 plasmid pCL2100, complete sequence 25641-25673 8 0.758
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 313523-313555 8 0.758
NC_014644_2 2.16|837357|33|NC_014644|PILER-CR 837357-837389 33 KU686197 Synechococcus phage S-CAM3 isolate 0808SB25, complete genome 72113-72145 8 0.758
NC_014644_2 2.16|837357|33|NC_014644|PILER-CR 837357-837389 33 KU686199 Synechococcus phage S-CAM3 isolate 1010CC42, complete genome 72099-72131 8 0.758
NC_014644_2 2.16|837357|33|NC_014644|PILER-CR 837357-837389 33 KU686198 Synechococcus phage S-CAM3 isolate 0910TB04, complete genome 72105-72137 8 0.758
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693202 Marine virus AFVG_25M396, complete genome 16746-16778 8 0.758
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693175 Marine virus AFVG_25M140, complete genome 15916-15948 8 0.758
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693603 Marine virus AFVG_25M138, complete genome 20894-20926 8 0.758
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 NZ_CP007767 Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence 30355-30387 8 0.758
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 NZ_CP044261 Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence 29040-29072 8 0.758
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 NC_012040 Campylobacter lari RM2100 plasmid pCL2100, complete sequence 25641-25673 8 0.758
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 313523-313555 8 0.758
NC_014644_2 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT 837351-837383 33 KU686197 Synechococcus phage S-CAM3 isolate 0808SB25, complete genome 72113-72145 8 0.758
NC_014644_2 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT 837351-837383 33 KU686199 Synechococcus phage S-CAM3 isolate 1010CC42, complete genome 72099-72131 8 0.758
NC_014644_2 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT 837351-837383 33 KU686198 Synechococcus phage S-CAM3 isolate 0910TB04, complete genome 72105-72137 8 0.758
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693202 Marine virus AFVG_25M396, complete genome 16746-16778 8 0.758
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693175 Marine virus AFVG_25M140, complete genome 15916-15948 8 0.758
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693603 Marine virus AFVG_25M138, complete genome 20894-20926 8 0.758
NC_014644_1 1.1|418218|36|NC_014644|PILER-CR 418218-418253 36 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 201448-201483 9 0.75
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 36248-36280 9 0.727
NC_014644_2 2.9|836930|33|NC_014644|PILER-CR 836930-836962 33 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 191518-191550 9 0.727
NC_014644_2 2.15|837296|33|NC_014644|PILER-CR 837296-837328 33 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 344065-344097 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694387 Marine virus AFVG_250M329, complete genome 26222-26254 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN693994 Marine virus AFVG_250M330, complete genome 26085-26117 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694465 Marine virus AFVG_250M1200, complete genome 27024-27056 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694767 Marine virus AFVG_250M328, complete genome 26230-26262 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694500 Marine virus AFVG_250M1198, complete genome 27064-27096 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694373 Marine virus AFVG_250M164, complete genome 26406-26438 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694400 Marine virus AFVG_250M1011, complete genome 26764-26796 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694490 Marine virus AFVG_250M148, complete genome 27065-27097 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN693851 Marine virus AFVG_250M123, complete genome 26749-26781 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN693612 Marine virus AFVG_250M85, complete genome 27370-27402 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694262 Marine virus AFVG_250M733, complete genome 27159-27191 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MT601271 Bacillus phage vB_BsuM-Goe10, complete genome 78348-78380 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 KY368639 Bacillus phage vB_BsuM-Goe2, complete genome 76292-76324 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 KF669649 Bacillus phage CampHawk, complete genome 76951-76983 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN693857 Marine virus AFVG_250M1199, complete genome 27070-27102 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 NC_011421 Bacillus phage SPO1, complete genome 76065-76097 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN693690 Marine virus AFVG_250M149, complete genome 14454-14486 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694569 Marine virus AFVG_250M103, complete genome 16321-16353 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694581 Marine virus AFVG_250M102, complete genome 16318-16350 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MN694308 Marine virus AFVG_250M150, complete genome 14456-14488 9 0.727
NC_014644_2 2.19|837540|33|NC_014644|PILER-CR 837540-837572 33 MH153807 Rhodococcus phage Peregrin, complete genome 43544-43576 9 0.727
NC_014644_2 2.22|837723|33|NC_014644|PILER-CR 837723-837755 33 NZ_CP004860 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence 278571-278603 9 0.727
NC_014644_2 2.22|837723|33|NC_014644|PILER-CR 837723-837755 33 NZ_CP007616 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence 99851-99883 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693463 Marine virus AFVG_25M283, complete genome 15471-15503 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693331 Marine virus AFVG_25M281, complete genome 21040-21072 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693334 Marine virus AFVG_25M282, complete genome 21030-21062 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MN693110 Marine virus AFVG_25M284, complete genome 21056-21088 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 MH319721 Marine virus AG-345-D19 Ga0172267_102 genomic sequence 816-848 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 KX229736 Campylobacter phage PC5, complete genome 88077-88109 9 0.727
NC_014644_2 2.27|838028|33|NC_014644|PILER-CR 838028-838060 33 NC_015386 Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence 69412-69444 9 0.727
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 NZ_CP007625 Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence 36248-36280 9 0.727
NC_014644_2 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT 836924-836956 33 NZ_CP009650 Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence 191518-191550 9 0.727
NC_014644_2 2.40|837290|33|NC_014644|CRISPRCasFinder,CRT 837290-837322 33 NZ_CP045351 Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence 344065-344097 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694387 Marine virus AFVG_250M329, complete genome 26222-26254 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN693994 Marine virus AFVG_250M330, complete genome 26085-26117 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694465 Marine virus AFVG_250M1200, complete genome 27024-27056 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694767 Marine virus AFVG_250M328, complete genome 26230-26262 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694500 Marine virus AFVG_250M1198, complete genome 27064-27096 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694373 Marine virus AFVG_250M164, complete genome 26406-26438 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694400 Marine virus AFVG_250M1011, complete genome 26764-26796 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694490 Marine virus AFVG_250M148, complete genome 27065-27097 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN693851 Marine virus AFVG_250M123, complete genome 26749-26781 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN693612 Marine virus AFVG_250M85, complete genome 27370-27402 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694262 Marine virus AFVG_250M733, complete genome 27159-27191 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MT601271 Bacillus phage vB_BsuM-Goe10, complete genome 78348-78380 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 KY368639 Bacillus phage vB_BsuM-Goe2, complete genome 76292-76324 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 KF669649 Bacillus phage CampHawk, complete genome 76951-76983 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN693857 Marine virus AFVG_250M1199, complete genome 27070-27102 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 NC_011421 Bacillus phage SPO1, complete genome 76065-76097 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN693690 Marine virus AFVG_250M149, complete genome 14454-14486 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694569 Marine virus AFVG_250M103, complete genome 16321-16353 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694581 Marine virus AFVG_250M102, complete genome 16318-16350 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MN694308 Marine virus AFVG_250M150, complete genome 14456-14488 9 0.727
NC_014644_2 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT 837534-837566 33 MH153807 Rhodococcus phage Peregrin, complete genome 43544-43576 9 0.727
NC_014644_2 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT 837717-837749 33 NZ_CP004860 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence 278571-278603 9 0.727
NC_014644_2 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT 837717-837749 33 NZ_CP007616 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence 99851-99883 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693463 Marine virus AFVG_25M283, complete genome 15471-15503 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693331 Marine virus AFVG_25M281, complete genome 21040-21072 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693334 Marine virus AFVG_25M282, complete genome 21030-21062 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MN693110 Marine virus AFVG_25M284, complete genome 21056-21088 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 MH319721 Marine virus AG-345-D19 Ga0172267_102 genomic sequence 816-848 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 KX229736 Campylobacter phage PC5, complete genome 88077-88109 9 0.727
NC_014644_2 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT 838022-838054 33 NC_015386 Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence 69412-69444 9 0.727
NC_014644_3 3.1|1124220|30|NC_014644|CRISPRCasFinder 1124220-1124249 30 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 64565-64594 9 0.7
NC_014644_1 1.1|418218|36|NC_014644|PILER-CR 418218-418253 36 EU826470 Mycobacterium phage Solon, complete genome 29066-29101 10 0.722
NC_014644_2 2.25|837906|33|NC_014644|PILER-CR 837906-837938 33 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 503522-503554 10 0.697
NC_014644_2 2.50|837900|33|NC_014644|CRISPRCasFinder,CRT 837900-837932 33 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 503522-503554 10 0.697
NC_014644_1 1.1|418218|36|NC_014644|PILER-CR 418218-418253 36 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1095429-1095464 11 0.694
NC_014644_2 2.12|837113|33|NC_014644|PILER-CR 837113-837145 33 NC_048652 Bacillus phage vB_BsuM-Goe3, complete genome 86022-86054 11 0.667
NC_014644_2 2.12|837113|33|NC_014644|PILER-CR 837113-837145 33 MN043730 Bacillus phage vB_BveM-Goe7, complete genome 88078-88110 11 0.667
NC_014644_2 2.13|837174|33|NC_014644|PILER-CR 837174-837206 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 919574-919606 11 0.667
NC_014644_2 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT 837107-837139 33 NC_048652 Bacillus phage vB_BsuM-Goe3, complete genome 86022-86054 11 0.667
NC_014644_2 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT 837107-837139 33 MN043730 Bacillus phage vB_BveM-Goe7, complete genome 88078-88110 11 0.667
NC_014644_2 2.38|837168|33|NC_014644|CRISPRCasFinder,CRT 837168-837200 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 919574-919606 11 0.667

1. spacer 2.12|837113|33|NC_014644|PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 6, identity: 0.818

cactcttgtagatgctgtgcttgag---cggcttat	CRISPR spacer
cactcttgtagatgcttggcttgagaatcggtt---	Protospacer
****************  *******   ***.*   

2. spacer 2.27|838028|33|NC_014644|PILER-CR matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.818

-tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gtgacca-tgtaccatcttttaatgcttttgcga	Protospacer
 ** * * **************** *** *** *

3. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 6, identity: 0.818

cactcttgtagatgctgtgcttgag---cggcttat	CRISPR spacer
cactcttgtagatgcttggcttgagaatcggtt---	Protospacer
****************  *******   ***.*   

4. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.818

-tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gtgacca-tgtaccatcttttaatgcttttgcga	Protospacer
 ** * * **************** *** *** *

5. spacer 2.9|836930|33|NC_014644|PILER-CR matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tatcaatttaagagcgaaaagaaa---agtttttat	CRISPR spacer
catcaatttaagaacgaaaataaaatgagcttt---	Protospacer
.************.****** ***   **.***   

6. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tatcaatttaagagcgaaaagaaa---agtttttat	CRISPR spacer
catcaatttaagaacgaaaataaaatgagcttt---	Protospacer
.************.****** ***   **.***   

7. spacer 3.1|1124220|30|NC_014644|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tttccgctttttgttgctctacacaccatt	CRISPR spacer
gctgcgctttttgttggtctacccaccaag	Protospacer
 .* ************ ***** *****  

8. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

9. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

10. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NC_012040 (Campylobacter lari RM2100 plasmid pCL2100, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

11. spacer 2.9|836930|33|NC_014644|PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaa-gtttttat	CRISPR spacer
catcaacttaagagcgaaaacaaaataaatcta-	Protospacer
.*****.************* **** .  *.** 

12. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

13. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

14. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

15. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693202 (Marine virus AFVG_25M396, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

16. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693175 (Marine virus AFVG_25M140, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

17. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693603 (Marine virus AFVG_25M138, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

18. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

19. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

20. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NC_012040 (Campylobacter lari RM2100 plasmid pCL2100, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac	Protospacer
* *..  *** **** ****************.

21. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758

tatcaatttaagagcgaaaagaaaa-gtttttat	CRISPR spacer
catcaacttaagagcgaaaacaaaataaatcta-	Protospacer
.*****.************* **** .  *.** 

22. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

23. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

24. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 8, identity: 0.758

tattttccttattttgagctaataataaattta	CRISPR spacer
tgtatgtgctattttgagataatagtaaattta	Protospacer
*.* * . .********* *****.********

25. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693202 (Marine virus AFVG_25M396, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

26. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693175 (Marine virus AFVG_25M140, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

27. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693603 (Marine virus AFVG_25M138, complete genome) position: , mismatch: 8, identity: 0.758

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg	Protospacer
 .. **.********************** .*.

28. spacer 1.1|418218|36|NC_014644|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.75

aacggcggtggtcgcggtcgcggtggtcgcggaggc	CRISPR spacer
cccggcgggggtcgccgtcgcggtggtcgggcgtgt	Protospacer
  ****** ****** ************* * . *.

29. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt	Protospacer
.*****.************* ****    .* *

30. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 9, identity: 0.727

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt	Protospacer
.*****.************* ****    .* *

31. spacer 2.15|837296|33|NC_014644|PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.727

tatggcattaaacggcattgacatatcatggta	CRISPR spacer
tgcggcattaaaaggcattaacatatcaataag	Protospacer
*..********* ******.********  . .

32. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694387 (Marine virus AFVG_250M329, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

33. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693994 (Marine virus AFVG_250M330, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

34. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694465 (Marine virus AFVG_250M1200, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

35. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694767 (Marine virus AFVG_250M328, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

36. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694500 (Marine virus AFVG_250M1198, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

37. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694373 (Marine virus AFVG_250M164, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

38. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694400 (Marine virus AFVG_250M1011, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

39. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694490 (Marine virus AFVG_250M148, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

40. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693851 (Marine virus AFVG_250M123, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

41. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693612 (Marine virus AFVG_250M85, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

42. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694262 (Marine virus AFVG_250M733, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

43. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MT601271 (Bacillus phage vB_BsuM-Goe10, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

44. spacer 2.19|837540|33|NC_014644|PILER-CR matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

45. spacer 2.19|837540|33|NC_014644|PILER-CR matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

46. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693857 (Marine virus AFVG_250M1199, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

47. spacer 2.19|837540|33|NC_014644|PILER-CR matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

48. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693690 (Marine virus AFVG_250M149, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

49. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694569 (Marine virus AFVG_250M103, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

50. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694581 (Marine virus AFVG_250M102, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

51. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694308 (Marine virus AFVG_250M150, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

52. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MH153807 (Rhodococcus phage Peregrin, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
agagcttgtaaacgcgcatgtagatatgttagt	Protospacer
 ************** * *******..  *. *

53. spacer 2.22|837723|33|NC_014644|PILER-CR matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 9, identity: 0.727

caaacgttcttcattgcttgcattgcaaaatta	CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa	Protospacer
  * . ***.******* ************  *

54. spacer 2.22|837723|33|NC_014644|PILER-CR matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 9, identity: 0.727

caaacgttcttcattgcttgcattgcaaaatta	CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa	Protospacer
  * . ***.******* ************  *

55. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693463 (Marine virus AFVG_25M283, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

56. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693331 (Marine virus AFVG_25M281, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

57. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693334 (Marine virus AFVG_25M282, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

58. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693110 (Marine virus AFVG_25M284, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

59. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MH319721 (Marine virus AG-345-D19 Ga0172267_102 genomic sequence) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
atttctttgttccttcttttaattcttgtgcca	Protospacer
  *.   *** ** *****************.*

60. spacer 2.27|838028|33|NC_014644|PILER-CR matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
atgcaactgcaccatcttttaattctttaatta	Protospacer
   *** **.*****************  ..**

61. spacer 2.27|838028|33|NC_014644|PILER-CR matches to NC_015386 (Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattc-ttgtgcta	CRISPR spacer
ctgcaagtttaccagcttttaattctttatatt-	Protospacer
.  ***** ***** ********** **.*..* 

62. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt	Protospacer
.*****.************* ****    .* *

63. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 9, identity: 0.727

tatcaatttaagagcgaaaagaaaagtttttat	CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt	Protospacer
.*****.************* ****    .* *

64. spacer 2.40|837290|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.727

tatggcattaaacggcattgacatatcatggta	CRISPR spacer
tgcggcattaaaaggcattaacatatcaataag	Protospacer
*..********* ******.********  . .

65. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694387 (Marine virus AFVG_250M329, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

66. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693994 (Marine virus AFVG_250M330, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

67. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694465 (Marine virus AFVG_250M1200, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

68. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694767 (Marine virus AFVG_250M328, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

69. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694500 (Marine virus AFVG_250M1198, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

70. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694373 (Marine virus AFVG_250M164, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

71. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694400 (Marine virus AFVG_250M1011, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

72. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694490 (Marine virus AFVG_250M148, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

73. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693851 (Marine virus AFVG_250M123, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

74. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693612 (Marine virus AFVG_250M85, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

75. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694262 (Marine virus AFVG_250M733, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

76. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MT601271 (Bacillus phage vB_BsuM-Goe10, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

77. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

78. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

79. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693857 (Marine virus AFVG_250M1199, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

80. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt	Protospacer
  *..***************** * ****   *

81. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693690 (Marine virus AFVG_250M149, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

82. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694569 (Marine virus AFVG_250M103, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

83. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694581 (Marine virus AFVG_250M102, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

84. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694308 (Marine virus AFVG_250M150, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca	Protospacer
   *..******.** ************** * 

85. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MH153807 (Rhodococcus phage Peregrin, complete genome) position: , mismatch: 9, identity: 0.727

tgagcttgtaaacgctcttgtagatgctgtgct	CRISPR spacer
agagcttgtaaacgcgcatgtagatatgttagt	Protospacer
 ************** * *******..  *. *

86. spacer 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 9, identity: 0.727

caaacgttcttcattgcttgcattgcaaaatta	CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa	Protospacer
  * . ***.******* ************  *

87. spacer 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 9, identity: 0.727

caaacgttcttcattgcttgcattgcaaaatta	CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa	Protospacer
  * . ***.******* ************  *

88. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693463 (Marine virus AFVG_25M283, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

89. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693331 (Marine virus AFVG_25M281, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

90. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693334 (Marine virus AFVG_25M282, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

91. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693110 (Marine virus AFVG_25M284, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg	Protospacer
 .. **.** ******************* .*.

92. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MH319721 (Marine virus AG-345-D19 Ga0172267_102 genomic sequence) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
atttctttgttccttcttttaattcttgtgcca	Protospacer
  *.   *** ** *****************.*

93. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattcttgtgcta	CRISPR spacer
atgcaactgcaccatcttttaattctttaatta	Protospacer
   *** **.*****************  ..**

94. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to NC_015386 (Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence) position: , mismatch: 9, identity: 0.727

tgtcaagtgtaccatcttttaattc-ttgtgcta	CRISPR spacer
ctgcaagtttaccagcttttaattctttatatt-	Protospacer
.  ***** ***** ********** **.*..* 

95. spacer 3.1|1124220|30|NC_014644|CRISPRCasFinder matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.7

tttccgctttttgttgctctacacaccatt	CRISPR spacer
gcggggttttttgttgctccacacaccaca	Protospacer
 .   *.************.********. 

96. spacer 1.1|418218|36|NC_014644|PILER-CR matches to EU826470 (Mycobacterium phage Solon, complete genome) position: , mismatch: 10, identity: 0.722

aacggcggtggtcgcggtcgcggtggtcgcggaggc	CRISPR spacer
ggcggcggtggtggcggtggcggtggtcagaccagc	Protospacer
..********** ***** *********. .  .**

97. spacer 2.25|837906|33|NC_014644|PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgaagcctgcgaagtgttcctgctggaatgttt	CRISPR spacer
gtacagctgcgcagtgttcctgctgggatggac	Protospacer
  * . ***** **************.***  .

98. spacer 2.50|837900|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

cgaagcctgcgaagtgttcctgctggaatgttt	CRISPR spacer
gtacagctgcgcagtgttcctgctgggatggac	Protospacer
  * . ***** **************.***  .

99. spacer 1.1|418218|36|NC_014644|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.694

aacggcggtggtcgcggtcgcggtggtcgcggaggc	CRISPR spacer
tcaggcggcggtcgcggtcgcggtgctcggcttcgt	Protospacer
   *****.**************** ***     *.

100. spacer 2.12|837113|33|NC_014644|PILER-CR matches to NC_048652 (Bacillus phage vB_BsuM-Goe3, complete genome) position: , mismatch: 11, identity: 0.667

cactcttgtagatgctgtgcttgagcggcttat	CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc	Protospacer
. .********* **** *********..   .

101. spacer 2.12|837113|33|NC_014644|PILER-CR matches to MN043730 (Bacillus phage vB_BveM-Goe7, complete genome) position: , mismatch: 11, identity: 0.667

cactcttgtagatgctgtgcttgagcggcttat	CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc	Protospacer
. .********* **** *********..   .

102. spacer 2.13|837174|33|NC_014644|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.667

gcgtcgtgccgcggcgtgcgatagtgtcatcga	CRISPR spacer
acgtactgccgcggcgtgcgatagtactcctcg	Protospacer
.***  *******************... .. .

103. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to NC_048652 (Bacillus phage vB_BsuM-Goe3, complete genome) position: , mismatch: 11, identity: 0.667

cactcttgtagatgctgtgcttgagcggcttat	CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc	Protospacer
. .********* **** *********..   .

104. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to MN043730 (Bacillus phage vB_BveM-Goe7, complete genome) position: , mismatch: 11, identity: 0.667

cactcttgtagatgctgtgcttgagcggcttat	CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc	Protospacer
. .********* **** *********..   .

105. spacer 2.38|837168|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.667

gcgtcgtgccgcggcgtgcgatagtgtcatcga	CRISPR spacer
acgtactgccgcggcgtgcgatagtactcctcg	Protospacer
.***  *******************... .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1629918 : 1636565 6 Mycobacterium_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage