1. spacer 2.12|837113|33|NC_014644|PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 6, identity: 0.818
cactcttgtagatgctgtgcttgag---cggcttat CRISPR spacer
cactcttgtagatgcttggcttgagaatcggtt--- Protospacer
**************** ******* ***.*
2. spacer 2.27|838028|33|NC_014644|PILER-CR matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.818
-tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gtgacca-tgtaccatcttttaatgcttttgcga Protospacer
** * * **************** *** *** *
3. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 6, identity: 0.818
cactcttgtagatgctgtgcttgag---cggcttat CRISPR spacer
cactcttgtagatgcttggcttgagaatcggtt--- Protospacer
**************** ******* ***.*
4. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.818
-tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gtgacca-tgtaccatcttttaatgcttttgcga Protospacer
** * * **************** *** *** *
5. spacer 2.9|836930|33|NC_014644|PILER-CR matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
tatcaatttaagagcgaaaagaaa---agtttttat CRISPR spacer
catcaatttaagaacgaaaataaaatgagcttt--- Protospacer
.************.****** *** **.***
6. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
tatcaatttaagagcgaaaagaaa---agtttttat CRISPR spacer
catcaatttaagaacgaaaataaaatgagcttt--- Protospacer
.************.****** *** **.***
7. spacer 3.1|1124220|30|NC_014644|CRISPRCasFinder matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tttccgctttttgttgctctacacaccatt CRISPR spacer
gctgcgctttttgttggtctacccaccaag Protospacer
.* ************ ***** *****
8. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
9. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
10. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NC_012040 (Campylobacter lari RM2100 plasmid pCL2100, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
11. spacer 2.9|836930|33|NC_014644|PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaa-gtttttat CRISPR spacer
catcaacttaagagcgaaaacaaaataaatcta- Protospacer
.*****.************* **** . *.**
12. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
13. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
14. spacer 2.16|837357|33|NC_014644|PILER-CR matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
15. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693202 (Marine virus AFVG_25M396, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
16. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693175 (Marine virus AFVG_25M140, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
17. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693603 (Marine virus AFVG_25M138, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
18. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007767 (Campylobacter peloridis LMG 23910 plasmid pPEL1, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
19. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
20. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NC_012040 (Campylobacter lari RM2100 plasmid pCL2100, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
ttttgcattatgagccaaaagaaaagtttttac Protospacer
* *.. *** **** ****************.
21. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758
tatcaatttaagagcgaaaagaaaa-gtttttat CRISPR spacer
catcaacttaagagcgaaaacaaaataaatcta- Protospacer
.*****.************* **** . *.**
22. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686197 (Synechococcus phage S-CAM3 isolate 0808SB25, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
23. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686199 (Synechococcus phage S-CAM3 isolate 1010CC42, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
24. spacer 2.41|837351|33|NC_014644|CRISPRCasFinder,CRT matches to KU686198 (Synechococcus phage S-CAM3 isolate 0910TB04, complete genome) position: , mismatch: 8, identity: 0.758
tattttccttattttgagctaataataaattta CRISPR spacer
tgtatgtgctattttgagataatagtaaattta Protospacer
*.* * . .********* *****.********
25. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693202 (Marine virus AFVG_25M396, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
26. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693175 (Marine virus AFVG_25M140, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
27. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693603 (Marine virus AFVG_25M138, complete genome) position: , mismatch: 8, identity: 0.758
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgtaccatcttttaattcttgtcttg Protospacer
.. **.********************** .*.
28. spacer 1.1|418218|36|NC_014644|PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.75
aacggcggtggtcgcggtcgcggtggtcgcggaggc CRISPR spacer
cccggcgggggtcgccgtcgcggtggtcgggcgtgt Protospacer
****** ****** ************* * . *.
29. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt Protospacer
.*****.************* **** .* *
30. spacer 2.9|836930|33|NC_014644|PILER-CR matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 9, identity: 0.727
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt Protospacer
.*****.************* **** .* *
31. spacer 2.15|837296|33|NC_014644|PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.727
tatggcattaaacggcattgacatatcatggta CRISPR spacer
tgcggcattaaaaggcattaacatatcaataag Protospacer
*..********* ******.******** . .
32. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694387 (Marine virus AFVG_250M329, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
33. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693994 (Marine virus AFVG_250M330, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
34. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694465 (Marine virus AFVG_250M1200, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
35. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694767 (Marine virus AFVG_250M328, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
36. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694500 (Marine virus AFVG_250M1198, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
37. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694373 (Marine virus AFVG_250M164, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
38. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694400 (Marine virus AFVG_250M1011, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
39. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694490 (Marine virus AFVG_250M148, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
40. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693851 (Marine virus AFVG_250M123, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
41. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693612 (Marine virus AFVG_250M85, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
42. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694262 (Marine virus AFVG_250M733, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
43. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MT601271 (Bacillus phage vB_BsuM-Goe10, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
44. spacer 2.19|837540|33|NC_014644|PILER-CR matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
45. spacer 2.19|837540|33|NC_014644|PILER-CR matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
46. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693857 (Marine virus AFVG_250M1199, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
47. spacer 2.19|837540|33|NC_014644|PILER-CR matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
48. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN693690 (Marine virus AFVG_250M149, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
49. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694569 (Marine virus AFVG_250M103, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
50. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694581 (Marine virus AFVG_250M102, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
51. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MN694308 (Marine virus AFVG_250M150, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
52. spacer 2.19|837540|33|NC_014644|PILER-CR matches to MH153807 (Rhodococcus phage Peregrin, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
agagcttgtaaacgcgcatgtagatatgttagt Protospacer
************** * *******.. *. *
53. spacer 2.22|837723|33|NC_014644|PILER-CR matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 9, identity: 0.727
caaacgttcttcattgcttgcattgcaaaatta CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa Protospacer
* . ***.******* ************ *
54. spacer 2.22|837723|33|NC_014644|PILER-CR matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 9, identity: 0.727
caaacgttcttcattgcttgcattgcaaaatta CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa Protospacer
* . ***.******* ************ *
55. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693463 (Marine virus AFVG_25M283, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
56. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693331 (Marine virus AFVG_25M281, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
57. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693334 (Marine virus AFVG_25M282, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
58. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MN693110 (Marine virus AFVG_25M284, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
59. spacer 2.27|838028|33|NC_014644|PILER-CR matches to MH319721 (Marine virus AG-345-D19 Ga0172267_102 genomic sequence) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
atttctttgttccttcttttaattcttgtgcca Protospacer
*. *** ** *****************.*
60. spacer 2.27|838028|33|NC_014644|PILER-CR matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
atgcaactgcaccatcttttaattctttaatta Protospacer
*** **.***************** ..**
61. spacer 2.27|838028|33|NC_014644|PILER-CR matches to NC_015386 (Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattc-ttgtgcta CRISPR spacer
ctgcaagtttaccagcttttaattctttatatt- Protospacer
. ***** ***** ********** **.*..*
62. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007625 (Bacillus pseudomycoides strain 219298 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt Protospacer
.*****.************* **** .* *
63. spacer 2.34|836924|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP009650 (Bacillus pseudomycoides strain BTZ plasmid pBTZ_1, complete sequence) position: , mismatch: 9, identity: 0.727
tatcaatttaagagcgaaaagaaaagtttttat CRISPR spacer
catcaacttaagagcgaaaataaaataaacttt Protospacer
.*****.************* **** .* *
64. spacer 2.40|837290|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 9, identity: 0.727
tatggcattaaacggcattgacatatcatggta CRISPR spacer
tgcggcattaaaaggcattaacatatcaataag Protospacer
*..********* ******.******** . .
65. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694387 (Marine virus AFVG_250M329, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
66. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693994 (Marine virus AFVG_250M330, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
67. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694465 (Marine virus AFVG_250M1200, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
68. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694767 (Marine virus AFVG_250M328, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
69. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694500 (Marine virus AFVG_250M1198, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
70. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694373 (Marine virus AFVG_250M164, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
71. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694400 (Marine virus AFVG_250M1011, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
72. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694490 (Marine virus AFVG_250M148, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
73. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693851 (Marine virus AFVG_250M123, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
74. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693612 (Marine virus AFVG_250M85, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
75. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694262 (Marine virus AFVG_250M733, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
76. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MT601271 (Bacillus phage vB_BsuM-Goe10, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
77. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to KY368639 (Bacillus phage vB_BsuM-Goe2, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
78. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to KF669649 (Bacillus phage CampHawk, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
79. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693857 (Marine virus AFVG_250M1199, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
80. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to NC_011421 (Bacillus phage SPO1, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
acaatttgtaaacgctcttgtacaagctggtgt Protospacer
*..***************** * **** *
81. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN693690 (Marine virus AFVG_250M149, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
82. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694569 (Marine virus AFVG_250M103, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
83. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694581 (Marine virus AFVG_250M102, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
84. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MN694308 (Marine virus AFVG_250M150, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
actgtctgtaaatgcgcttgtagatgctgtcca Protospacer
*..******.** ************** *
85. spacer 2.44|837534|33|NC_014644|CRISPRCasFinder,CRT matches to MH153807 (Rhodococcus phage Peregrin, complete genome) position: , mismatch: 9, identity: 0.727
tgagcttgtaaacgctcttgtagatgctgtgct CRISPR spacer
agagcttgtaaacgcgcatgtagatatgttagt Protospacer
************** * *******.. *. *
86. spacer 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP004860 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB422, complete sequence) position: , mismatch: 9, identity: 0.727
caaacgttcttcattgcttgcattgcaaaatta CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa Protospacer
* . ***.******* ************ *
87. spacer 2.47|837717|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007616 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB400, complete sequence) position: , mismatch: 9, identity: 0.727
caaacgttcttcattgcttgcattgcaaaatta CRISPR spacer
gcattcttcctcattgcatgcattgcaaaaaaa Protospacer
* . ***.******* ************ *
88. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693463 (Marine virus AFVG_25M283, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
89. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693331 (Marine virus AFVG_25M281, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
90. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693334 (Marine virus AFVG_25M282, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
91. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MN693110 (Marine virus AFVG_25M284, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
gacgaaatgaaccatcttttaattcttgtcttg Protospacer
.. **.** ******************* .*.
92. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to MH319721 (Marine virus AG-345-D19 Ga0172267_102 genomic sequence) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
atttctttgttccttcttttaattcttgtgcca Protospacer
*. *** ** *****************.*
93. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to KX229736 (Campylobacter phage PC5, complete genome) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattcttgtgcta CRISPR spacer
atgcaactgcaccatcttttaattctttaatta Protospacer
*** **.***************** ..**
94. spacer 2.52|838022|33|NC_014644|CRISPRCasFinder,CRT matches to NC_015386 (Treponema succinifaciens DSM 2489 plasmid pTRESU01, complete sequence) position: , mismatch: 9, identity: 0.727
tgtcaagtgtaccatcttttaattc-ttgtgcta CRISPR spacer
ctgcaagtttaccagcttttaattctttatatt- Protospacer
. ***** ***** ********** **.*..*
95. spacer 3.1|1124220|30|NC_014644|CRISPRCasFinder matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.7
tttccgctttttgttgctctacacaccatt CRISPR spacer
gcggggttttttgttgctccacacaccaca Protospacer
. *.************.********.
96. spacer 1.1|418218|36|NC_014644|PILER-CR matches to EU826470 (Mycobacterium phage Solon, complete genome) position: , mismatch: 10, identity: 0.722
aacggcggtggtcgcggtcgcggtggtcgcggaggc CRISPR spacer
ggcggcggtggtggcggtggcggtggtcagaccagc Protospacer
..********** ***** *********. . .**
97. spacer 2.25|837906|33|NC_014644|PILER-CR matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697
cgaagcctgcgaagtgttcctgctggaatgttt CRISPR spacer
gtacagctgcgcagtgttcctgctgggatggac Protospacer
* . ***** **************.*** .
98. spacer 2.50|837900|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697
cgaagcctgcgaagtgttcctgctggaatgttt CRISPR spacer
gtacagctgcgcagtgttcctgctgggatggac Protospacer
* . ***** **************.*** .
99. spacer 1.1|418218|36|NC_014644|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.694
aacggcggtggtcgcggtcgcggtggtcgcggaggc CRISPR spacer
tcaggcggcggtcgcggtcgcggtgctcggcttcgt Protospacer
*****.**************** *** *.
100. spacer 2.12|837113|33|NC_014644|PILER-CR matches to NC_048652 (Bacillus phage vB_BsuM-Goe3, complete genome) position: , mismatch: 11, identity: 0.667
cactcttgtagatgctgtgcttgagcggcttat CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc Protospacer
. .********* **** *********.. .
101. spacer 2.12|837113|33|NC_014644|PILER-CR matches to MN043730 (Bacillus phage vB_BveM-Goe7, complete genome) position: , mismatch: 11, identity: 0.667
cactcttgtagatgctgtgcttgagcggcttat CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc Protospacer
. .********* **** *********.. .
102. spacer 2.13|837174|33|NC_014644|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.667
gcgtcgtgccgcggcgtgcgatagtgtcatcga CRISPR spacer
acgtactgccgcggcgtgcgatagtactcctcg Protospacer
.*** *******************... .. .
103. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to NC_048652 (Bacillus phage vB_BsuM-Goe3, complete genome) position: , mismatch: 11, identity: 0.667
cactcttgtagatgctgtgcttgagcggcttat CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc Protospacer
. .********* **** *********.. .
104. spacer 2.37|837107|33|NC_014644|CRISPRCasFinder,CRT matches to MN043730 (Bacillus phage vB_BveM-Goe7, complete genome) position: , mismatch: 11, identity: 0.667
cactcttgtagatgctgtgcttgagcggcttat CRISPR spacer
ttttcttgtagaagctgagcttgagcgatagcc Protospacer
. .********* **** *********.. .
105. spacer 2.38|837168|33|NC_014644|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.667
gcgtcgtgccgcggcgtgcgatagtgtcatcga CRISPR spacer
acgtactgccgcggcgtgcgatagtactcctcg Protospacer
.*** *******************... .. .