Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014504 Gloeothece verrucosa PCC 7822 plasmid Cy782205, complete sequence 0 crisprs c2c9_V-U4,cas14j 0 0 0 0
NC_014502 Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence 1 crisprs DEDDh,cas3 0 2 1 0
NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 8 crisprs RT,Cas9_archaeal,cas14j,cas1,cas2,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,cas5,cas7,cas8b3,cas6,PD-DExK,c2c5_V-U5 0 20 3 0
NC_014535 Gloeothece verrucosa PCC 7822 plasmid Cy782206, complete sequence 0 crisprs NA 0 0 0 0
NC_014503 Gloeothece verrucosa PCC 7822 plasmid Cy782204, complete sequence 1 crisprs cas14j 0 1 0 0
NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 6 crisprs cmr3gr5,cmr4gr7,cmr5gr11,cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL,2OG_CAS,csx18,cas8b3,c2c9_V-U4,cmr6gr7,cas10 0 118 2 0
NC_014501 Gloeothece verrucosa PCC 7822, complete sequence 17 crisprs DEDDh,DinG,PD-DExK,c2c9_V-U4,cas14k,cas3,cas14j,Cas14c_CAS-V-F,csa3,RT,Cas9_archaeal,Cas14b_CAS-V-F,csx3,csx1 3 6 2 0

Results visualization

1. NC_014503
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014503_1 6886-6971 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014503_1 1.1|6909|40|NC_014503|CRISPRCasFinder 6909-6948 40 NC_014503 Gloeothece verrucosa PCC 7822 plasmid Cy782204, complete sequence 6909-6948 0 1.0

1. spacer 1.1|6909|40|NC_014503|CRISPRCasFinder matches to NC_014503 (Gloeothece verrucosa PCC 7822 plasmid Cy782204, complete sequence) position: , mismatch: 0, identity: 1.0

ccacccaggagcgcgatgaacttaagatgaaggtagaaga	CRISPR spacer
ccacccaggagcgcgatgaacttaagatgaaggtagaaga	Protospacer
****************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_014502
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014502_1 148518-148670 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014502_1 1.1|148540|46|NC_014502|PILER-CR 148540-148585 46 NC_014502 Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence 148538-148583 0 1.0
NC_014502_1 1.2|148608|43|NC_014502|PILER-CR 148608-148650 43 NC_014502 Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence 148606-148648 0 1.0

1. spacer 1.1|148540|46|NC_014502|PILER-CR matches to NC_014502 (Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcttaaaaatatcctaatttctcgttgtgtcaagtagactctca	CRISPR spacer
tgtcttaaaaatatcctaatttctcgttgtgtcaagtagactctca	Protospacer
**********************************************

2. spacer 1.2|148608|43|NC_014502|PILER-CR matches to NC_014502 (Gloeothece verrucosa PCC 7822 plasmid Cy782203, complete sequence) position: , mismatch: 0, identity: 1.0

cggaggttggacaaacaggctaattcagattcctacttttttc	CRISPR spacer
cggaggttggacaaacaggctaattcagattcctacttttttc	Protospacer
*******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13873 : 43305 39 Aphanizomenon_phage(33.33%) integrase,transposase attL 41865:41882|attR 47053:47070
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_014533
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_1 21043-23249 TypeIII-C NA
29 spacers
cmr3gr5,cmr4gr7,cmr5gr11,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_2 44680-46461 TypeI-D V-U2
24 spacers
cmr5gr11,cmr4gr7,cmr3gr5,cas2,cas1,cas4,cas6,csc1gr5,csc2gr7,cas10d,cas3,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_3 208812-209007 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_4 487679-488993 Unclear NA
17 spacers
cas2,cas1,csx18

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_5 841042-841965 TypeIII NA
12 spacers
cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,cas2,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014533_6 846786-849039 TypeIII NA
31 spacers
cas1,cas2,cas10,cmr3gr5,cmr4gr7,cmr5gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014533_1 1.1|21079|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21079-21114 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21079-21114 0 1.0
NC_014533_1 1.2|21151|44|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21151-21194 44 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21151-21194 0 1.0
NC_014533_1 1.3|21231|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21231-21268 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21231-21268 0 1.0
NC_014533_1 1.4|21305|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21305-21342 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21305-21342 0 1.0
NC_014533_1 1.5|21379|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21379-21416 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21379-21416 0 1.0
NC_014533_1 1.6|21453|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21453-21490 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21453-21490 0 1.0
NC_014533_1 1.7|21527|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21527-21568 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21527-21568 0 1.0
NC_014533_1 1.8|21605|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21605-21644 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21605-21644 0 1.0
NC_014533_1 1.9|21681|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21681-21722 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21681-21722 0 1.0
NC_014533_1 1.10|21759|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21759-21795 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21759-21795 0 1.0
NC_014533_1 1.11|21832|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21832-21873 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21832-21873 0 1.0
NC_014533_1 1.12|21910|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21910-21945 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21910-21945 0 1.0
NC_014533_1 1.13|21982|43|NC_014533|PILER-CR,CRISPRCasFinder,CRT 21982-22024 43 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 21982-22024 0 1.0
NC_014533_1 1.14|22061|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22061-22098 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22061-22098 0 1.0
NC_014533_1 1.15|22135|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22135-22172 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22135-22172 0 1.0
NC_014533_1 1.16|22209|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22209-22248 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22209-22248 0 1.0
NC_014533_1 1.17|22285|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22285-22320 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22285-22320 0 1.0
NC_014533_1 1.18|22357|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22357-22393 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22357-22393 0 1.0
NC_014533_1 1.19|22430|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22430-22470 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22430-22470 0 1.0
NC_014533_1 1.20|22507|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22507-22544 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22507-22544 0 1.0
NC_014533_1 1.21|22581|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22581-22617 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22581-22617 0 1.0
NC_014533_1 1.22|22654|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22654-22690 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22654-22690 0 1.0
NC_014533_1 1.23|22727|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22727-22766 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22727-22766 0 1.0
NC_014533_1 1.24|22803|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22803-22841 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22803-22841 0 1.0
NC_014533_1 1.25|22878|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT 22878-22918 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22878-22918 0 1.0
NC_014533_1 1.26|22955|38|NC_014533|CRISPRCasFinder,CRT 22955-22992 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 22955-22992 0 1.0
NC_014533_1 1.27|23029|35|NC_014533|CRISPRCasFinder,CRT 23029-23063 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 23029-23063 0 1.0
NC_014533_1 1.28|23100|39|NC_014533|CRISPRCasFinder,CRT 23100-23138 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 23100-23138 0 1.0
NC_014533_1 1.29|23175|39|NC_014533|CRISPRCasFinder,CRT 23175-23213 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 23175-23213 0 1.0
NC_014533_2 2.1|44717|38|NC_014533|CRT 44717-44754 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 44717-44754 0 1.0
NC_014533_2 2.2|44792|42|NC_014533|CRT,PILER-CR,CRISPRCasFinder 44792-44833 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 44792-44833 0 1.0
NC_014533_2 2.3|44871|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder 44871-44907 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 44871-44907 0 1.0
NC_014533_2 2.4|44945|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder 44945-44980 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 44945-44980 0 1.0
NC_014533_2 2.5|45018|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45018-45051 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45018-45051 0 1.0
NC_014533_2 2.6|45089|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45089-45123 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45089-45123 0 1.0
NC_014533_2 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45161-45194 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45161-45194 0 1.0
NC_014533_2 2.8|45232|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45232-45267 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45232-45267 0 1.0
NC_014533_2 2.9|45305|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45305-45340 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45305-45340 0 1.0
NC_014533_2 2.10|45378|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45378-45413 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45378-45413 0 1.0
NC_014533_2 2.11|45451|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45451-45487 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45451-45487 0 1.0
NC_014533_2 2.12|45525|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45525-45559 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45525-45559 0 1.0
NC_014533_2 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45597-45630 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45597-45630 0 1.0
NC_014533_2 2.14|45668|33|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45668-45700 33 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45668-45700 0 1.0
NC_014533_2 2.15|45738|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45738-45772 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45738-45772 0 1.0
NC_014533_2 2.16|45810|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45810-45844 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45810-45844 0 1.0
NC_014533_2 2.17|45882|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45882-45918 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45882-45918 0 1.0
NC_014533_2 2.18|45956|33|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45956-45988 33 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 45956-45988 0 1.0
NC_014533_2 2.19|46026|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46026-46062 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46026-46062 0 1.0
NC_014533_2 2.20|46100|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46100-46133 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46100-46133 0 1.0
NC_014533_2 2.21|46171|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46171-46204 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46171-46204 0 1.0
NC_014533_2 2.22|46242|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46242-46276 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46242-46276 0 1.0
NC_014533_2 2.23|46314|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46314-46349 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46314-46349 0 1.0
NC_014533_2 2.24|46387|38|NC_014533|CRT,PILER-CR,CRISPRCasFinder 46387-46424 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 46387-46424 0 1.0
NC_014533_3 3.1|208860|43|NC_014533|PILER-CR 208860-208902 43 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 208836-208878 0 1.0
NC_014533_3 3.2|208951|35|NC_014533|PILER-CR 208951-208985 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 208927-208961 0 1.0
NC_014533_4 4.1|487715|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 487715-487753 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 487715-487753 0 1.0
NC_014533_4 4.2|487790|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 487790-487831 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 487790-487831 0 1.0
NC_014533_4 4.3|487868|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT 487868-487908 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 487868-487908 0 1.0
NC_014533_4 4.4|487945|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 487945-487980 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 487945-487980 0 1.0
NC_014533_4 4.5|488017|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488017-488055 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488017-488055 0 1.0
NC_014533_4 4.6|488092|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488092-488127 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488092-488127 0 1.0
NC_014533_4 4.7|488164|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488164-488202 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488164-488202 0 1.0
NC_014533_4 4.8|488239|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488239-488275 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488239-488275 0 1.0
NC_014533_4 4.9|488312|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488312-488351 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488312-488351 0 1.0
NC_014533_4 4.10|488388|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488388-488423 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488388-488423 0 1.0
NC_014533_4 4.11|488460|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488460-488499 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488460-488499 0 1.0
NC_014533_4 4.12|488536|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488536-488577 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488536-488577 0 1.0
NC_014533_4 4.13|488614|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 488614-488655 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488614-488655 0 1.0
NC_014533_4 4.14|488692|36|NC_014533|CRISPRCasFinder,CRT 488692-488727 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488692-488727 0 1.0
NC_014533_4 4.15|488764|46|NC_014533|CRISPRCasFinder,CRT 488764-488809 46 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488764-488809 0 1.0
NC_014533_4 4.16|488846|40|NC_014533|CRISPRCasFinder,CRT 488846-488885 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488846-488885 0 1.0
NC_014533_4 4.17|488922|36|NC_014533|CRISPRCasFinder,CRT 488922-488957 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488922-488957 0 1.0
NC_014533_4 4.18|488764|45|NC_014533|PILER-CR 488764-488808 45 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488764-488808 0 1.0
NC_014533_4 4.19|488846|39|NC_014533|PILER-CR 488846-488884 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488846-488884 0 1.0
NC_014533_4 4.20|488922|35|NC_014533|PILER-CR 488922-488956 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 488922-488956 0 1.0
NC_014533_5 5.1|841078|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841078-841119 42 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841078-841119 0 1.0
NC_014533_5 5.2|841156|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841156-841193 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841156-841193 0 1.0
NC_014533_5 5.3|841230|35|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841230-841264 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841230-841264 0 1.0
NC_014533_5 5.4|841301|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841301-841338 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841301-841338 0 1.0
NC_014533_5 5.5|841375|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841375-841411 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841375-841411 0 1.0
NC_014533_5 5.6|841448|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841448-841486 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841448-841486 0 1.0
NC_014533_5 5.7|841523|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841523-841561 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841523-841561 0 1.0
NC_014533_5 5.8|841598|35|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841598-841632 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841598-841632 0 1.0
NC_014533_5 5.9|841669|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841669-841706 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841669-841706 0 1.0
NC_014533_5 5.10|841743|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841743-841783 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841743-841783 0 1.0
NC_014533_5 5.11|841820|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841820-841856 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841820-841856 0 1.0
NC_014533_5 5.12|841893|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT 841893-841929 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 841893-841929 0 1.0
NC_014533_6 6.1|846821|36|NC_014533|CRISPRCasFinder,CRT 846821-846856 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 846821-846856 0 1.0
NC_014533_6 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 846892-846925 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 846892-846925 0 1.0
NC_014533_6 6.3|846961|38|NC_014533|CRISPRCasFinder,CRT,PILER-CR 846961-846998 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 846961-846998 0 1.0
NC_014533_6 6.4|847034|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847034-847070 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847034-847070 0 1.0
NC_014533_6 6.5|847106|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847106-847140 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847106-847140 0 1.0
NC_014533_6 6.6|847176|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847176-847214 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847176-847214 0 1.0
NC_014533_6 6.7|847250|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847250-847288 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847250-847288 0 1.0
NC_014533_6 6.8|847324|38|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847324-847361 38 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847324-847361 0 1.0
NC_014533_6 6.9|847397|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847397-847430 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847397-847430 0 1.0
NC_014533_6 6.10|847466|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847466-847502 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847466-847502 0 1.0
NC_014533_6 6.11|847538|32|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847538-847569 32 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847538-847569 0 1.0
NC_014533_6 6.12|847605|41|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847605-847645 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847605-847645 0 1.0
NC_014533_6 6.13|847681|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847681-847717 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847681-847717 0 1.0
NC_014533_6 6.14|847753|41|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847753-847793 41 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847753-847793 0 1.0
NC_014533_6 6.15|847829|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847829-847867 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847829-847867 0 1.0
NC_014533_6 6.16|847903|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847903-847937 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847903-847937 0 1.0
NC_014533_6 6.17|847973|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR 847973-848009 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 847973-848009 0 1.0
NC_014533_6 6.18|848045|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848045-848078 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848045-848078 0 1.0
NC_014533_6 6.19|848114|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848114-848147 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848114-848147 0 1.0
NC_014533_6 6.20|848183|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848183-848221 39 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848183-848221 0 1.0
NC_014533_6 6.21|848257|40|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848257-848296 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848257-848296 0 1.0
NC_014533_6 6.22|848332|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848332-848368 37 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848332-848368 0 1.0
NC_014533_6 6.23|848404|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848404-848439 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848404-848439 0 1.0
NC_014533_6 6.24|848475|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848475-848509 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848475-848509 0 1.0
NC_014533_6 6.25|848545|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848545-848580 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848545-848580 0 1.0
NC_014533_6 6.26|848616|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848616-848650 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848616-848650 0 1.0
NC_014533_6 6.27|848686|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848686-848720 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848686-848720 0 1.0
NC_014533_6 6.28|848756|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848756-848791 36 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848756-848791 0 1.0
NC_014533_6 6.29|848827|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848827-848860 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848827-848860 0 1.0
NC_014533_6 6.30|848896|40|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848896-848935 40 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848896-848935 0 1.0
NC_014533_6 6.31|848971|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 848971-849004 34 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 848971-849004 0 1.0
NC_014533_3 3.2|208951|35|NC_014533|PILER-CR 208951-208985 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 209008-209042 3 0.914
NC_014533_3 3.2|208951|35|NC_014533|PILER-CR 208951-208985 35 NC_014533 Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence 208846-208880 7 0.8
NC_014533_2 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45161-45194 34 JX195166 Pectobacterium phage My1, complete genome 70825-70858 9 0.735
NC_014533_6 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 846892-846925 34 MN694142 Marine virus AFVG_250M416, complete genome 64614-64647 9 0.735
NC_014533_2 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45597-45630 34 NZ_CP024217 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-9 3517-3550 10 0.706
NC_014533_2 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45597-45630 34 NZ_CP024209 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-2 17155-17188 10 0.706
NC_014533_2 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45597-45630 34 NZ_CP040828 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-cp30-2, complete sequence 2106-2139 10 0.706
NC_014533_3 3.2|208951|35|NC_014533|PILER-CR 208951-208985 35 MN694517 Marine virus AFVG_250M306, complete genome 45080-45114 10 0.714
NC_014533_6 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 846892-846925 34 MN693786 Marine virus AFVG_250M1027, complete genome 63337-63370 10 0.706
NC_014533_6 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR 846892-846925 34 MN693811 Marine virus AFVG_250M463, complete genome 64417-64450 10 0.706
NC_014533_2 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder 45161-45194 34 NZ_CP031276 Staphylococcus xylosus strain 2 plasmid unnamed1, complete sequence 13456-13489 11 0.676

1. spacer 1.1|21079|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aaggatttggtatcgatttctcatgtcctcaatagg	CRISPR spacer
aaggatttggtatcgatttctcatgtcctcaatagg	Protospacer
************************************

2. spacer 1.2|21151|44|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tcaattatttacttacattcacttgtatctatattatgactgaa	CRISPR spacer
tcaattatttacttacattcacttgtatctatattatgactgaa	Protospacer
********************************************

3. spacer 1.3|21231|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tatattttcagcacctggcaatacctttaagttagcag	CRISPR spacer
tatattttcagcacctggcaatacctttaagttagcag	Protospacer
**************************************

4. spacer 1.4|21305|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aaatctactctaatttctgtggggattggagtcactat	CRISPR spacer
aaatctactctaatttctgtggggattggagtcactat	Protospacer
**************************************

5. spacer 1.5|21379|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgatcacctcgctgttcggggactccgccaaagacctc	CRISPR spacer
cgatcacctcgctgttcggggactccgccaaagacctc	Protospacer
**************************************

6. spacer 1.6|21453|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aggttcgagaagcccttctcctccatccagagggcgta	CRISPR spacer
aggttcgagaagcccttctcctccatccagagggcgta	Protospacer
**************************************

7. spacer 1.7|21527|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aggaactcggtcgcccccagctcgtccctgatctcgaaccac	CRISPR spacer
aggaactcggtcgcccccagctcgtccctgatctcgaaccac	Protospacer
******************************************

8. spacer 1.8|21605|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ccgatggcggcatcgtgatgcgggaggtcggcgggtcgaa	CRISPR spacer
ccgatggcggcatcgtgatgcgggaggtcggcgggtcgaa	Protospacer
****************************************

9. spacer 1.9|21681|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gcttaattataagctttcgagtcaggttaacttgatatagac	CRISPR spacer
gcttaattataagctttcgagtcaggttaacttgatatagac	Protospacer
******************************************

10. spacer 1.10|21759|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gcagtttgaactccagtcaccccaactacctggaata	CRISPR spacer
gcagtttgaactccagtcaccccaactacctggaata	Protospacer
*************************************

11. spacer 1.11|21832|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gttgcgcacggtgaccgggaccagctcggcggcccgttgccc	CRISPR spacer
gttgcgcacggtgaccgggaccagctcggcggcccgttgccc	Protospacer
******************************************

12. spacer 1.12|21910|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gagtacctctgttactatggcaattcttccttttct	CRISPR spacer
gagtacctctgttactatggcaattcttccttttct	Protospacer
************************************

13. spacer 1.13|21982|43|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aagcattttttccctctaccaccttaagaacaccacttgtgta	CRISPR spacer
aagcattttttccctctaccaccttaagaacaccacttgtgta	Protospacer
*******************************************

14. spacer 1.14|22061|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tatgtcacccatgccaattcaccctattattacttgtg	CRISPR spacer
tatgtcacccatgccaattcaccctattattacttgtg	Protospacer
**************************************

15. spacer 1.15|22135|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aggttctcctaggaattcattctttttaaaattattta	CRISPR spacer
aggttctcctaggaattcattctttttaaaattattta	Protospacer
**************************************

16. spacer 1.16|22209|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctttctgccttgccagagtaaaagtgtgtactctttttct	CRISPR spacer
ctttctgccttgccagagtaaaagtgtgtactctttttct	Protospacer
****************************************

17. spacer 1.17|22285|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttctgtaatcctttccccgccgcctgtccaacatc	CRISPR spacer
tttctgtaatcctttccccgccgcctgtccaacatc	Protospacer
************************************

18. spacer 1.18|22357|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgccgccgacgtgaacgaacgcgcgatcttcacggag	CRISPR spacer
cgccgccgacgtgaacgaacgcgcgatcttcacggag	Protospacer
*************************************

19. spacer 1.19|22430|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgatctttacattcgcggttgaatgacggcagaaaaactca	CRISPR spacer
cgatctttacattcgcggttgaatgacggcagaaaaactca	Protospacer
*****************************************

20. spacer 1.20|22507|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tggaggaaatagacagcgatggaaggcggtataaaatt	CRISPR spacer
tggaggaaatagacagcgatggaaggcggtataaaatt	Protospacer
**************************************

21. spacer 1.21|22581|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

attgaatcgctagaacgcccttcctgtctccattctc	CRISPR spacer
attgaatcgctagaacgcccttcctgtctccattctc	Protospacer
*************************************

22. spacer 1.22|22654|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gtccttaaacgacttaaggactttagccagttcttac	CRISPR spacer
gtccttaaacgacttaaggactttagccagttcttac	Protospacer
*************************************

23. spacer 1.23|22727|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttcgttttacttattcatacgatatttgcaacaatatcc	CRISPR spacer
tttcgttttacttattcatacgatatttgcaacaatatcc	Protospacer
****************************************

24. spacer 1.24|22803|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aataattaaaacattttgatgctcgttacaaagagctaa	CRISPR spacer
aataattaaaacattttgatgctcgttacaaagagctaa	Protospacer
***************************************

25. spacer 1.25|22878|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aactccttcgcgcgctttgccgtgccgcccgtcgccgcgtt	CRISPR spacer
aactccttcgcgcgctttgccgtgccgcccgtcgccgcgtt	Protospacer
*****************************************

26. spacer 1.26|22955|38|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gcattcttaacaaatgctctaattttctgcaatctgat	CRISPR spacer
gcattcttaacaaatgctctaattttctgcaatctgat	Protospacer
**************************************

27. spacer 1.27|23029|35|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aagtaatcatctggcttttgattatggaatctccg	CRISPR spacer
aagtaatcatctggcttttgattatggaatctccg	Protospacer
***********************************

28. spacer 1.28|23100|39|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cggggtttacaaaaaggttggcatttaccttgatccgcc	CRISPR spacer
cggggtttacaaaaaggttggcatttaccttgatccgcc	Protospacer
***************************************

29. spacer 1.29|23175|39|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgcgagcgaccgaggacatcggccagcagatccgggc	CRISPR spacer
ggcgcgagcgaccgaggacatcggccagcagatccgggc	Protospacer
***************************************

30. spacer 2.1|44717|38|NC_014533|CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tgaattcttgttgtgttctgttggagatattaaagaaa	CRISPR spacer
tgaattcttgttgtgttctgttggagatattaaagaaa	Protospacer
**************************************

31. spacer 2.2|44792|42|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tagaaagggctttgttaaggcttgaaaaaatagaaaattttt	CRISPR spacer
tagaaagggctttgttaaggcttgaaaaaatagaaaattttt	Protospacer
******************************************

32. spacer 2.3|44871|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aacggcaaacttaaaactgttgttgacaacaatgagt	CRISPR spacer
aacggcaaacttaaaactgttgttgacaacaatgagt	Protospacer
*************************************

33. spacer 2.4|44945|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

agtcgatattgaaacaaatatcaatcgattagcgtt	CRISPR spacer
agtcgatattgaaacaaatatcaatcgattagcgtt	Protospacer
************************************

34. spacer 2.5|45018|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cctaattatcctggcaaaatggacggaagtctta	CRISPR spacer
cctaattatcctggcaaaatggacggaagtctta	Protospacer
**********************************

35. spacer 2.6|45089|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttccattaaccgtcctcgatgggaagaactttat	CRISPR spacer
tttccattaaccgtcctcgatgggaagaactttat	Protospacer
***********************************

36. spacer 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gtatcgtcctttgttttaacatttaacttatagc	CRISPR spacer
gtatcgtcctttgttttaacatttaacttatagc	Protospacer
**********************************

37. spacer 2.8|45232|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgcatcttatctggttccgttggtttgttttgt	CRISPR spacer
tgttgcatcttatctggttccgttggtttgttttgt	Protospacer
************************************

38. spacer 2.9|45305|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

acaataagaattcagataattcagcgaaatatctat	CRISPR spacer
acaataagaattcagataattcagcgaaatatctat	Protospacer
************************************

39. spacer 2.10|45378|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gaaggatcaataggactaccaacattaaatttagaa	CRISPR spacer
gaaggatcaataggactaccaacattaaatttagaa	Protospacer
************************************

40. spacer 2.11|45451|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctataggaggatcaggtgttaaaacaaaaattctcgg	CRISPR spacer
ctataggaggatcaggtgttaaaacaaaaattctcgg	Protospacer
*************************************

41. spacer 2.12|45525|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttgactcttcttctttgtcttgacaaatatattt	CRISPR spacer
tttgactcttcttctttgtcttgacaaatatattt	Protospacer
***********************************

42. spacer 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ccggacattgactataaggtaacacaattattat	CRISPR spacer
ccggacattgactataaggtaacacaattattat	Protospacer
**********************************

43. spacer 2.14|45668|33|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgctcatagctcaaaattcgtaagaacagtttc	CRISPR spacer
cgctcatagctcaaaattcgtaagaacagtttc	Protospacer
*********************************

44. spacer 2.15|45738|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

catcaattataaacaaatgatagacgattacttat	CRISPR spacer
catcaattataaacaaatgatagacgattacttat	Protospacer
***********************************

45. spacer 2.16|45810|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tacctatttctagtttagatatcaagttgttaaca	CRISPR spacer
tacctatttctagtttagatatcaagttgttaaca	Protospacer
***********************************

46. spacer 2.17|45882|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

atagatgaattaatactacgtgacagtattccgttaa	CRISPR spacer
atagatgaattaatactacgtgacagtattccgttaa	Protospacer
*************************************

47. spacer 2.18|45956|33|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

acaaatccgcagcataactacaccattttgtta	CRISPR spacer
acaaatccgcagcataactacaccattttgtta	Protospacer
*********************************

48. spacer 2.19|46026|37|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ccccgcgaaatggggctaaaaaagcctctaaagggtc	CRISPR spacer
ccccgcgaaatggggctaaaaaagcctctaaagggtc	Protospacer
*************************************

49. spacer 2.20|46100|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tggcaatccaaattcaggaccatttgaagctgga	CRISPR spacer
tggcaatccaaattcaggaccatttgaagctgga	Protospacer
**********************************

50. spacer 2.21|46171|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

taaacgattgtgttctagtttcaacggatacaat	CRISPR spacer
taaacgattgtgttctagtttcaacggatacaat	Protospacer
**********************************

51. spacer 2.22|46242|35|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cctgatcctcctatagaatggctaagatgtaaatt	CRISPR spacer
cctgatcctcctatagaatggctaagatgtaaatt	Protospacer
***********************************

52. spacer 2.23|46314|36|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

taacatctagtaataaaagtggcgttaatttattag	CRISPR spacer
taacatctagtaataaaagtggcgttaatttattag	Protospacer
************************************

53. spacer 2.24|46387|38|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttgcaagtttgtgttgtaaacgattgcacagtaacatc	CRISPR spacer
ttgcaagtttgtgttgtaaacgattgcacagtaacatc	Protospacer
**************************************

54. spacer 3.1|208860|43|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cacctaacctctatcagttctgactccaatggagatgggcagc	CRISPR spacer
cacctaacctctatcagttctgactccaatggagatgggcagc	Protospacer
*******************************************

55. spacer 3.2|208951|35|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctgacactactgactccaatggagatgggctggcc	CRISPR spacer
ctgacactactgactccaatggagatgggctggcc	Protospacer
***********************************

56. spacer 4.1|487715|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gctatttggggggctgaatctcaagctcctcaatgatag	CRISPR spacer
gctatttggggggctgaatctcaagctcctcaatgatag	Protospacer
***************************************

57. spacer 4.2|487790|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gttttgccataacagataaactctttgaaaggaatcaagggg	CRISPR spacer
gttttgccataacagataaactctttgaaaggaatcaagggg	Protospacer
******************************************

58. spacer 4.3|487868|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttcagaacaaatttaatggtttaaaaaattcaatcatcaaa	CRISPR spacer
ttcagaacaaatttaatggtttaaaaaattcaatcatcaaa	Protospacer
*****************************************

59. spacer 4.4|487945|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aatatatgttaagcgagcttgcaacgcttatgaact	CRISPR spacer
aatatatgttaagcgagcttgcaacgcttatgaact	Protospacer
************************************

60. spacer 4.5|488017|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gtaattttcaggagggcttacacagagtttactaaccct	CRISPR spacer
gtaattttcaggagggcttacacagagtttactaaccct	Protospacer
***************************************

61. spacer 4.6|488092|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctctaacagcgtcgccgatttcttgttgctgttctt	CRISPR spacer
ctctaacagcgtcgccgatttcttgttgctgttctt	Protospacer
************************************

62. spacer 4.7|488164|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

attatgatgtagccaaatgcggagctactttaacttgga	CRISPR spacer
attatgatgtagccaaatgcggagctactttaacttgga	Protospacer
***************************************

63. spacer 4.8|488239|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tagagccaaatcagcaatgataaagcatccatcacca	CRISPR spacer
tagagccaaatcagcaatgataaagcatccatcacca	Protospacer
*************************************

64. spacer 4.9|488312|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

accactcctagaggaaagtataaacaagacgacgatccct	CRISPR spacer
accactcctagaggaaagtataaacaagacgacgatccct	Protospacer
****************************************

65. spacer 4.10|488388|36|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttttaaaaaaaagtgcagtaaactaaagctattggt	CRISPR spacer
ttttaaaaaaaagtgcagtaaactaaagctattggt	Protospacer
************************************

66. spacer 4.11|488460|40|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctgcatattcctcccacccacaacgaagcagaccagagtg	CRISPR spacer
ctgcatattcctcccacccacaacgaagcagaccagagtg	Protospacer
****************************************

67. spacer 4.12|488536|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aatctattagctaatcctcatgtaactgttgttatgattctc	CRISPR spacer
aatctattagctaatcctcatgtaactgttgttatgattctc	Protospacer
******************************************

68. spacer 4.13|488614|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgacatcatctacaacaagacgaagattgatatccttct	CRISPR spacer
tggtgacatcatctacaacaagacgaagattgatatccttct	Protospacer
******************************************

69. spacer 4.14|488692|36|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

attgatgggccatactcaatccatcccccctgaatt	CRISPR spacer
attgatgggccatactcaatccatcccccctgaatt	Protospacer
************************************

70. spacer 4.15|488764|46|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

agtcctaataatcgcagagacaacaaaatcaatgttagtcgcggag	CRISPR spacer
agtcctaataatcgcagagacaacaaaatcaatgttagtcgcggag	Protospacer
**********************************************

71. spacer 4.16|488846|40|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tagaagatttagatccgcttgagaatttggaagccgtttt	CRISPR spacer
tagaagatttagatccgcttgagaatttggaagccgtttt	Protospacer
****************************************

72. spacer 4.17|488922|36|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ggacaggtggctctcgtctttaagctcaatggtcgt	CRISPR spacer
ggacaggtggctctcgtctttaagctcaatggtcgt	Protospacer
************************************

73. spacer 4.18|488764|45|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

agtcctaataatcgcagagacaacaaaatcaatgttagtcgcgga	CRISPR spacer
agtcctaataatcgcagagacaacaaaatcaatgttagtcgcgga	Protospacer
*********************************************

74. spacer 4.19|488846|39|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tagaagatttagatccgcttgagaatttggaagccgttt	CRISPR spacer
tagaagatttagatccgcttgagaatttggaagccgttt	Protospacer
***************************************

75. spacer 4.20|488922|35|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ggacaggtggctctcgtctttaagctcaatggtcg	CRISPR spacer
ggacaggtggctctcgtctttaagctcaatggtcg	Protospacer
***********************************

76. spacer 5.1|841078|42|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aggtgcaaaaatgaatgaagaaaaagacaagtattttattta	CRISPR spacer
aggtgcaaaaatgaatgaagaaaaagacaagtattttattta	Protospacer
******************************************

77. spacer 5.2|841156|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttttatatagttatggaaaagatcaaaaattatataga	CRISPR spacer
ttttatatagttatggaaaagatcaaaaattatataga	Protospacer
**************************************

78. spacer 5.3|841230|35|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aaatactactgattctgaaagaagaaaacaattaa	CRISPR spacer
aaatactactgattctgaaagaagaaaacaattaa	Protospacer
***********************************

79. spacer 5.4|841301|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gccaaaaaatgtagtggccgaatcgcgccagttgacgg	CRISPR spacer
gccaaaaaatgtagtggccgaatcgcgccagttgacgg	Protospacer
**************************************

80. spacer 5.5|841375|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ggatcaaaccagacgcgaagaattcgaccgcaagcaa	CRISPR spacer
ggatcaaaccagacgcgaagaattcgaccgcaagcaa	Protospacer
*************************************

81. spacer 5.6|841448|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aaacaaattaattctgaataatcaagcttttccatgttc	CRISPR spacer
aaacaaattaattctgaataatcaagcttttccatgttc	Protospacer
***************************************

82. spacer 5.7|841523|39|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttttgaaggataatgaattattgctttttccatttgagg	CRISPR spacer
ttttgaaggataatgaattattgctttttccatttgagg	Protospacer
***************************************

83. spacer 5.8|841598|35|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttctatttattacctattatccttttaataatcc	CRISPR spacer
tttctatttattacctattatccttttaataatcc	Protospacer
***********************************

84. spacer 5.9|841669|38|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

atttatggcttaactccaagctcgggaacagttctcac	CRISPR spacer
atttatggcttaactccaagctcgggaacagttctcac	Protospacer
**************************************

85. spacer 5.10|841743|41|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aaatttactgatatctgataaaaaagtaccaatttccgtga	CRISPR spacer
aaatttactgatatctgataaaaaagtaccaatttccgtga	Protospacer
*****************************************

86. spacer 5.11|841820|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

agaagtcagtcgaacagttcaagaagcctataaaaga	CRISPR spacer
agaagtcagtcgaacagttcaagaagcctataaaaga	Protospacer
*************************************

87. spacer 5.12|841893|37|NC_014533|PILER-CR,CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tctaaataccaaagctataaaaataacaaagggaaga	CRISPR spacer
tctaaataccaaagctataaaaataacaaagggaaga	Protospacer
*************************************

88. spacer 6.1|846821|36|NC_014533|CRISPRCasFinder,CRT matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cattcaagtagaaaaacaggaactatggaaacattt	CRISPR spacer
cattcaagtagaaaaacaggaactatggaaacattt	Protospacer
************************************

89. spacer 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ccttattatttgggggacggaagtaactttatgt	CRISPR spacer
ccttattatttgggggacggaagtaactttatgt	Protospacer
**********************************

90. spacer 6.3|846961|38|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cttatgaacagcttgctcaacgtgctggtctgatttaa	CRISPR spacer
cttatgaacagcttgctcaacgtgctggtctgatttaa	Protospacer
**************************************

91. spacer 6.4|847034|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tggtgctgaattagccgcatcgttttcgggcgggatt	CRISPR spacer
tggtgctgaattagccgcatcgttttcgggcgggatt	Protospacer
*************************************

92. spacer 6.5|847106|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ggatgaaaaaatcgaacgagcatttgaattataca	CRISPR spacer
ggatgaaaaaatcgaacgagcatttgaattataca	Protospacer
***********************************

93. spacer 6.6|847176|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ccccttcaatatgcagatgttgaagttcaaggacaggct	CRISPR spacer
ccccttcaatatgcagatgttgaagttcaaggacaggct	Protospacer
***************************************

94. spacer 6.7|847250|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

aacatgggaaacctggcaaggttttgtagcaataaggct	CRISPR spacer
aacatgggaaacctggcaaggttttgtagcaataaggct	Protospacer
***************************************

95. spacer 6.8|847324|38|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cagcgacgaaaaatggcaaaaactagacgaataaaatg	CRISPR spacer
cagcgacgaaaaatggcaaaaactagacgaataaaatg	Protospacer
**************************************

96. spacer 6.9|847397|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaattcctagggatagcagtagctgtactatt	CRISPR spacer
cgcaattcctagggatagcagtagctgtactatt	Protospacer
**********************************

97. spacer 6.10|847466|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ctttagcgcagaactttggtttcaaccaaggaacaaa	CRISPR spacer
ctttagcgcagaactttggtttcaaccaaggaacaaa	Protospacer
*************************************

98. spacer 6.11|847538|32|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

atataaaccaattcacgagggccattagaaga	CRISPR spacer
atataaaccaattcacgagggccattagaaga	Protospacer
********************************

99. spacer 6.12|847605|41|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tttaaaaattatctaatagactatgtagggaaggtaaaatc	CRISPR spacer
tttaaaaattatctaatagactatgtagggaaggtaaaatc	Protospacer
*****************************************

100. spacer 6.13|847681|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttcggttaaacactgaacgtgtcaatcgggatctaac	CRISPR spacer
ttcggttaaacactgaacgtgtcaatcgggatctaac	Protospacer
*************************************

101. spacer 6.14|847753|41|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

actccaactatgaggaaataatctcgccctatcttgagaca	CRISPR spacer
actccaactatgaggaaataatctcgccctatcttgagaca	Protospacer
*****************************************

102. spacer 6.15|847829|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tctacttattcaacgagatctttgttgacccatatcttc	CRISPR spacer
tctacttattcaacgagatctttgttgacccatatcttc	Protospacer
***************************************

103. spacer 6.16|847903|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

atcgttcagaaatcttttacaatatcaacacaaac	CRISPR spacer
atcgttcagaaatcttttacaatatcaacacaaac	Protospacer
***********************************

104. spacer 6.17|847973|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

ttttatgtattttttgggggggaggctgatctttgaa	CRISPR spacer
ttttatgtattttttgggggggaggctgatctttgaa	Protospacer
*************************************

105. spacer 6.18|848045|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgttactggttttctcaagaatcagtagatgatg	CRISPR spacer
cgttactggttttctcaagaatcagtagatgatg	Protospacer
**********************************

106. spacer 6.19|848114|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cagtgaagcagataaacagcttgtttatcgtcaa	CRISPR spacer
cagtgaagcagataaacagcttgtttatcgtcaa	Protospacer
**********************************

107. spacer 6.20|848183|39|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

catcaaaaagatagccagttgcttgaatggcacgctaaa	CRISPR spacer
catcaaaaagatagccagttgcttgaatggcacgctaaa	Protospacer
***************************************

108. spacer 6.21|848257|40|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tatcctgatgtattttcttgcggggtgcattttcaatgca	CRISPR spacer
tatcctgatgtattttcttgcggggtgcattttcaatgca	Protospacer
****************************************

109. spacer 6.22|848332|37|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tgttataaatacaaacggacgggttacatttgaaaca	CRISPR spacer
tgttataaatacaaacggacgggttacatttgaaaca	Protospacer
*************************************

110. spacer 6.23|848404|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtggtaccagttataaccctgcccgggttcaata	CRISPR spacer
tcgtggtaccagttataaccctgcccgggttcaata	Protospacer
************************************

111. spacer 6.24|848475|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cggtgacgacggtatcgatattatcgatgctacgc	CRISPR spacer
cggtgacgacggtatcgatattatcgatgctacgc	Protospacer
***********************************

112. spacer 6.25|848545|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

gagtatcgaaacggagggatggcatcagtcacacaa	CRISPR spacer
gagtatcgaaacggagggatggcatcagtcacacaa	Protospacer
************************************

113. spacer 6.26|848616|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

cgtttaatgcaaatttcccaagctactgcacccag	CRISPR spacer
cgtttaatgcaaatttcccaagctactgcacccag	Protospacer
***********************************

114. spacer 6.27|848686|35|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

acgtacgataatagaatcctcaaatgaggaggaag	CRISPR spacer
acgtacgataatagaatcctcaaatgaggaggaag	Protospacer
***********************************

115. spacer 6.28|848756|36|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tatgccactttacttcctgtggctgcaagaaaaaca	CRISPR spacer
tatgccactttacttcctgtggctgcaagaaaaaca	Protospacer
************************************

116. spacer 6.29|848827|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

atttttccaaagtttccaaaatgatgcgcagata	CRISPR spacer
atttttccaaagtttccaaaatgatgcgcagata	Protospacer
**********************************

117. spacer 6.30|848896|40|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tataacactcccataagagtgttgagtagtgtcggtagct	CRISPR spacer
tataacactcccataagagtgttgagtagtgtcggtagct	Protospacer
****************************************

118. spacer 6.31|848971|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 0, identity: 1.0

tagtcaagatggcaagttcactgtaaatttcaga	CRISPR spacer
tagtcaagatggcaagttcactgtaaatttcaga	Protospacer
**********************************

119. spacer 3.2|208951|35|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 3, identity: 0.914

ctgacactactgactccaatggagatgggctggcc	CRISPR spacer
ctgacactattgactccaatgcagatgggctggct	Protospacer
*********.*********** ************.

120. spacer 3.2|208951|35|NC_014533|PILER-CR matches to NC_014533 (Gloeothece verrucosa PCC 7822 plasmid Cy782201, complete sequence) position: , mismatch: 7, identity: 0.8

ctgacactactgactccaatggagatgggctggcc	CRISPR spacer
ctatcagttctgactccaatggagatgggcagcct	Protospacer
**. ** * ********************* * *.

121. spacer 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to JX195166 (Pectobacterium phage My1, complete genome) position: , mismatch: 9, identity: 0.735

gtatcgtccttt-gttttaacatttaacttatagc	CRISPR spacer
-tacagttccttggtcttaacatttaacttatcag	Protospacer
 **. **.*.** **.**************** . 

122. spacer 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to MN694142 (Marine virus AFVG_250M416, complete genome) position: , mismatch: 9, identity: 0.735

ccttattatttgggggacggaagtaactttatgt	CRISPR spacer
ggaagaaatttgggggtcggaagtaactttattt	Protospacer
    .  ********* *************** *

123. spacer 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024217 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-9) position: , mismatch: 10, identity: 0.706

ccggacattgactataaggtaacacaattattat	CRISPR spacer
ttgataaaatactttaaggtaaaacaattattat	Protospacer
..*.  *   *** ******** ***********

124. spacer 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024209 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-2) position: , mismatch: 10, identity: 0.706

ccggacattgactataaggtaacacaattattat	CRISPR spacer
ttgataaaatactttaaggtaaaacaattattat	Protospacer
..*.  *   *** ******** ***********

125. spacer 2.13|45597|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040828 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-cp30-2, complete sequence) position: , mismatch: 10, identity: 0.706

ccggacattgactataaggtaacacaattattat	CRISPR spacer
ttgataaaatactttaaggtaaaacaattattat	Protospacer
..*.  *   *** ******** ***********

126. spacer 3.2|208951|35|NC_014533|PILER-CR matches to MN694517 (Marine virus AFVG_250M306, complete genome) position: , mismatch: 10, identity: 0.714

ctgacactactgactccaatggagatgggctggcc	CRISPR spacer
tcatttcaaatgactccaatgtagatgggttggcc	Protospacer
... . * * *********** *******.*****

127. spacer 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to MN693786 (Marine virus AFVG_250M1027, complete genome) position: , mismatch: 10, identity: 0.706

ccttattatttgggggacggaagtaactttatgt	CRISPR spacer
ggaagaaatttggggctcggaagtaactttattt	Protospacer
    .  ********  *************** *

128. spacer 6.2|846892|34|NC_014533|CRISPRCasFinder,CRT,PILER-CR matches to MN693811 (Marine virus AFVG_250M463, complete genome) position: , mismatch: 10, identity: 0.706

ccttattatttgggggacggaagtaactttatgt	CRISPR spacer
ggaagaaatttgggggtcggaagtaacattattt	Protospacer
    .  ********* ********** **** *

129. spacer 2.7|45161|34|NC_014533|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031276 (Staphylococcus xylosus strain 2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

gtatcgtcctttgttttaacatttaacttatagc	CRISPR spacer
tctgtatactttgtttcaaaatttaacttatatg	Protospacer
 .  ..* ********.** ************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 171662 : 179935 8 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_2 782263 : 821952 39 Microcystis_virus(40.0%) transposase,capsid,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_014534
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_1 125521-125703 Unclear I-A,I-B,II-B
2 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_2 161319-161463 TypeV NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_3 161625-161870 TypeV NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_4 236763-237089 TypeIII NA
4 spacers
cas1,cas2,cas10,cmr3gr5,cmr4gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_5 241869-242349 TypeIII NA
6 spacers
cas2,cas1,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_6 280376-280489 TypeV NA
1 spacers
cas14j,RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_7 290411-290684 TypeV NA
3 spacers
cas5,cas7,cas8b3,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014534_8 389583-389685 TypeV-U5 NA
1 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014534_1 1.1|125559|34|NC_014534|CRISPRCasFinder 125559-125592 34 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 125559-125592 0 1.0
NC_014534_1 1.2|125631|35|NC_014534|CRISPRCasFinder 125631-125665 35 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 125631-125665 0 1.0
NC_014534_2 2.1|161361|60|NC_014534|CRISPRCasFinder 161361-161420 60 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 161361-161420 0 1.0
NC_014534_3 3.1|161667|60|NC_014534|CRISPRCasFinder 161667-161726 60 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 161667-161726 0 1.0
NC_014534_3 3.2|161769|60|NC_014534|CRISPRCasFinder 161769-161828 60 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 161769-161828 0 1.0
NC_014534_4 4.1|236798|33|NC_014534|PILER-CR,CRISPRCasFinder,CRT 236798-236830 33 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 236798-236830 0 1.0
NC_014534_4 4.2|236866|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 236866-236903 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 236866-236903 0 1.0
NC_014534_4 4.3|236939|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 236939-236976 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 236939-236976 0 1.0
NC_014534_4 4.4|237012|43|NC_014534|CRISPRCasFinder,CRT 237012-237054 43 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 237012-237054 0 1.0
NC_014534_5 5.1|241905|36|NC_014534|PILER-CR,CRISPRCasFinder,CRT 241905-241940 36 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 241905-241940 0 1.0
NC_014534_5 5.2|241977|41|NC_014534|PILER-CR,CRISPRCasFinder,CRT 241977-242017 41 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 241977-242017 0 1.0
NC_014534_5 5.3|242054|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 242054-242091 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 242054-242091 0 1.0
NC_014534_5 5.4|242128|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 242128-242165 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 242128-242165 0 1.0
NC_014534_5 5.5|242202|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 242202-242239 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 242202-242239 0 1.0
NC_014534_5 5.6|242276|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT 242276-242313 38 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 242276-242313 0 1.0
NC_014534_6 6.1|280403|60|NC_014534|CRISPRCasFinder 280403-280462 60 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 280403-280462 0 1.0
NC_014534_7 7.1|290446|37|NC_014534|CRISPRCasFinder 290446-290482 37 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 290446-290482 0 1.0
NC_014534_7 7.2|290518|43|NC_014534|CRISPRCasFinder 290518-290560 43 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 290518-290560 0 1.0
NC_014534_7 7.3|290596|54|NC_014534|CRISPRCasFinder 290596-290649 54 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 290596-290649 0 1.0
NC_014534_8 8.1|389612|45|NC_014534|CRISPRCasFinder 389612-389656 45 NC_014534 Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence 389612-389656 0 1.0
NC_014534_1 1.1|125559|34|NC_014534|CRISPRCasFinder 125559-125592 34 NZ_CP017256 Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence 81912-81945 8 0.765
NC_014534_1 1.1|125559|34|NC_014534|CRISPRCasFinder 125559-125592 34 MN693705 Marine virus AFVG_250M220, complete genome 33222-33255 10 0.706

1. spacer 1.1|125559|34|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

aggatgataaaggtaaaactaagtctattttagg	CRISPR spacer
aggatgataaaggtaaaactaagtctattttagg	Protospacer
**********************************

2. spacer 1.2|125631|35|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

tctcataatcgtccatttcttctaatttttttgtc	CRISPR spacer
tctcataatcgtccatttcttctaatttttttgtc	Protospacer
***********************************

3. spacer 2.1|161361|60|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

gctaaaactattgaaattaaccctcagtcagtaaatgcctacaaccagcgagggcttctt	CRISPR spacer
gctaaaactattgaaattaaccctcagtcagtaaatgcctacaaccagcgagggcttctt	Protospacer
************************************************************

4. spacer 3.1|161667|60|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaagtcattgaccttgatcctcagtgtacagaggcttatgaaaagcgaggcttactc	CRISPR spacer
agcaaagtcattgaccttgatcctcagtgtacagaggcttatgaaaagcgaggcttactc	Protospacer
************************************************************

5. spacer 3.2|161769|60|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

agcaaagctattgaacttaatccccaagatgatgcagaatatatagcaagaggctcattc	CRISPR spacer
agcaaagctattgaacttaatccccaagatgatgcagaatatatagcaagaggctcattc	Protospacer
************************************************************

6. spacer 4.1|236798|33|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

actgtttttacgtggcgctcagagtacgcagat	CRISPR spacer
actgtttttacgtggcgctcagagtacgcagat	Protospacer
*********************************

7. spacer 4.2|236866|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccattcctggcagtgtgtgaacatattcctgcaaa	CRISPR spacer
ttgccattcctggcagtgtgtgaacatattcctgcaaa	Protospacer
**************************************

8. spacer 4.3|236939|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

agcattaagtgcctctatttgagaggcttctagaaaca	CRISPR spacer
agcattaagtgcctctatttgagaggcttctagaaaca	Protospacer
**************************************

9. spacer 4.4|237012|43|NC_014534|CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcagactgcatagccacatataacaccctattatttaatt	CRISPR spacer
tgtgcagactgcatagccacatataacaccctattatttaatt	Protospacer
*******************************************

10. spacer 5.1|241905|36|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

ttcatcttctggtatctcctctatccttagcatctg	CRISPR spacer
ttcatcttctggtatctcctctatccttagcatctg	Protospacer
************************************

11. spacer 5.2|241977|41|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

ttatagttccctccacttattaatgccatctctcctgtcaa	CRISPR spacer
ttatagttccctccacttattaatgccatctctcctgtcaa	Protospacer
*****************************************

12. spacer 5.3|242054|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

cctgacaagcaagcaacgatatctcctttgattgtttg	CRISPR spacer
cctgacaagcaagcaacgatatctcctttgattgtttg	Protospacer
**************************************

13. spacer 5.4|242128|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

tccacagaagaaggtaaagtcttcctgcgccctcttat	CRISPR spacer
tccacagaagaaggtaaagtcttcctgcgccctcttat	Protospacer
**************************************

14. spacer 5.5|242202|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

ccagtattcaaattggaggttctctagctccaaaataa	CRISPR spacer
ccagtattcaaattggaggttctctagctccaaaataa	Protospacer
**************************************

15. spacer 5.6|242276|38|NC_014534|PILER-CR,CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

tccttggcagaatcttggcggcttatagaatcaaaagt	CRISPR spacer
tccttggcagaatcttggcggcttatagaatcaaaagt	Protospacer
**************************************

16. spacer 6.1|280403|60|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtataactcctgacgtgcaatagggataataacatcattagcgattggctgaacctg	CRISPR spacer
gaggtataactcctgacgtgcaatagggataataacatcattagcgattggctgaacctg	Protospacer
************************************************************

17. spacer 7.1|290446|37|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

aatggaacgggcaaaatgtaaaatgtaaacgaatccc	CRISPR spacer
aatggaacgggcaaaatgtaaaatgtaaacgaatccc	Protospacer
*************************************

18. spacer 7.2|290518|43|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

tatgctttattttgctattgatagccaaggaactgttcagtat	CRISPR spacer
tatgctttattttgctattgatagccaaggaactgttcagtat	Protospacer
*******************************************

19. spacer 7.3|290596|54|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

gacgcggtttcagcaactgaggcgggttcagcaacgaatcaagcccgattttct	CRISPR spacer
gacgcggtttcagcaactgaggcgggttcagcaacgaatcaagcccgattttct	Protospacer
******************************************************

20. spacer 8.1|389612|45|NC_014534|CRISPRCasFinder matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 0, identity: 1.0

cttaaaggaatagtaagaagccaagaacgaagttcttgtttcata	CRISPR spacer
cttaaaggaatagtaagaagccaagaacgaagttcttgtttcata	Protospacer
*********************************************

21. spacer 1.1|125559|34|NC_014534|CRISPRCasFinder matches to NZ_CP017256 (Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence) position: , mismatch: 8, identity: 0.765

aggatgataaaggtaaaactaagtctattttagg	CRISPR spacer
aaacagataaaggtaaaattaattctattttaat	Protospacer
*..  *************.*** *********. 

22. spacer 1.1|125559|34|NC_014534|CRISPRCasFinder matches to MN693705 (Marine virus AFVG_250M220, complete genome) position: , mismatch: 10, identity: 0.706

aggatgataaaggtaaaactaagtctattttagg	CRISPR spacer
tggatgataaaggaaatactaagtcagtaacatt	Protospacer
 ************ ** ******** .*  .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7900 : 81182 36 Moraxella_phage(16.67%) integrase,transposase attL 58353:58367|attR 89136:89150
DBSCAN-SWA_2 294258 : 358628 59 Enterobacteria_phage(28.57%) transposase,integrase attL 343480:343505|attR 356101:356126
DBSCAN-SWA_3 373179 : 431504 41 Bacillus_phage(33.33%) integrase,transposase,protease,tRNA attL 378403:378424|attR 401057:401078
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_014501
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_1 51929-52059 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_2 499730-499830 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_3 563929-564025 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_4 853231-853461 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_5 853645-853943 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_6 927016-927213 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_7 1320517-1320611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_8 1333852-1334337 Unclear NA
11 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_9 1837026-1837232 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_10 2470646-2470761 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_11 2548707-2548805 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_12 2644547-2644666 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_13 3470803-3470892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_14 3866790-3866878 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_15 3993552-3993652 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_16 4529883-4530104 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014501_17 4713519-4713650 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 NC_014501.1 927190-927219 2 0.933
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 NC_014501.1 927190-927219 2 0.933
NC_014501_6 6.4|927166|30|NC_014501|CRT 927166-927195 30 NC_014501.1 927010-927039 1 0.967

1. spacer 6.1|927034|30|NC_014501|CRT matches to position: 927190-927219, mismatch: 2, identity: 0.933

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cagaagaagtctctgaggaagtctctgagg	Protospacer
********.***********.*********

2. spacer 6.2|927082|30|NC_014501|CRT matches to position: 927190-927219, mismatch: 2, identity: 0.933

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cagaagaagtctctgaggaagtctctgagg	Protospacer
********.***********.*********

3. spacer 6.4|927166|30|NC_014501|CRT matches to position: 927010-927039, mismatch: 1, identity: 0.967

ctgaggaagtctctgaggaagtctcagaag	CRISPR spacer
ctgaggaagtctctgaggaaatctcagaag	Protospacer
********************.*********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 NZ_CP045386 Ruegeria sp. THAF33 plasmid pTHAF33_b, complete sequence 169856-169885 6 0.8
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 NZ_CP045386 Ruegeria sp. THAF33 plasmid pTHAF33_b, complete sequence 169856-169885 6 0.8
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 MF158043 Shigella phage Sf16, complete genome 12973-13002 7 0.767
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 MF327003 Shigella phage Sf14, complete genome 11082-11111 7 0.767
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 MF158043 Shigella phage Sf16, complete genome 12973-13002 7 0.767
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 MF327003 Shigella phage Sf14, complete genome 11082-11111 7 0.767
NC_014501_8 8.7|1334098|30|NC_014501|CRT 1334098-1334127 30 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 108501-108530 7 0.767
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 190987-191016 7 0.767
NC_014501_16 16.3|4529985|30|NC_014501|CRT 4529985-4530014 30 NZ_CP010885 Vibrio parahaemolyticus strain CHN25 plasmid P1, complete sequence 61718-61747 7 0.767
NC_014501_16 16.3|4529985|30|NC_014501|CRT 4529985-4530014 30 NZ_CP007006 Vibrio parahaemolyticus UCM-V493 plasmid pVPUCMV, complete sequence 30052-30081 7 0.767
NC_014501_16 16.3|4529985|30|NC_014501|CRT 4529985-4530014 30 NZ_CP019298 Vibrio campbellii strain LMB29 plasmid pLMB96, complete sequence 64444-64473 7 0.767
NC_014501_1 1.1|51952|31|NC_014501|CRISPRCasFinder 51952-51982 31 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 150482-150512 8 0.742
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 MK448904 Streptococcus phage Javan316, complete genome 33700-33729 8 0.733
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 NZ_CP014688 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence 313754-313783 8 0.733
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 MK448904 Streptococcus phage Javan316, complete genome 33700-33729 8 0.733
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 NZ_CP014688 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence 313754-313783 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 994406-994435 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1497838-1497867 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1497782-1497811 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 985388-985417 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1122943-1122972 8 0.733
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 848536-848565 8 0.733
NC_014501_8 8.7|1334098|30|NC_014501|CRT 1334098-1334127 30 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 358475-358504 9 0.7
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1249401-1249430 9 0.7
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1249408-1249437 9 0.7
NC_014501_8 8.10|1334254|30|NC_014501|CRT 1334254-1334283 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1176348-1176377 9 0.7
NC_014501_6 6.1|927034|30|NC_014501|CRT 927034-927063 30 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 36775-36804 10 0.667
NC_014501_6 6.2|927082|30|NC_014501|CRT 927082-927111 30 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 36775-36804 10 0.667

1. spacer 6.1|927034|30|NC_014501|CRT matches to NZ_CP045386 (Ruegeria sp. THAF33 plasmid pTHAF33_b, complete sequence) position: , mismatch: 6, identity: 0.8

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
tggcagaaatctctgtggaaatctccgaga	Protospacer
..* *********** *********.***.

2. spacer 6.2|927082|30|NC_014501|CRT matches to NZ_CP045386 (Ruegeria sp. THAF33 plasmid pTHAF33_b, complete sequence) position: , mismatch: 6, identity: 0.8

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
tggcagaaatctctgtggaaatctccgaga	Protospacer
..* *********** *********.***.

3. spacer 6.1|927034|30|NC_014501|CRT matches to MF158043 (Shigella phage Sf16, complete genome) position: , mismatch: 7, identity: 0.767

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cgaaagaaatctctgtggaagtctcttcag	Protospacer
*..************ ****.*****  .*

4. spacer 6.1|927034|30|NC_014501|CRT matches to MF327003 (Shigella phage Sf14, complete genome) position: , mismatch: 7, identity: 0.767

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cgaaagaaatctctgtggaagtctcttcag	Protospacer
*..************ ****.*****  .*

5. spacer 6.2|927082|30|NC_014501|CRT matches to MF158043 (Shigella phage Sf16, complete genome) position: , mismatch: 7, identity: 0.767

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cgaaagaaatctctgtggaagtctcttcag	Protospacer
*..************ ****.*****  .*

6. spacer 6.2|927082|30|NC_014501|CRT matches to MF327003 (Shigella phage Sf14, complete genome) position: , mismatch: 7, identity: 0.767

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
cgaaagaaatctctgtggaagtctcttcag	Protospacer
*..************ ****.*****  .*

7. spacer 8.7|1334098|30|NC_014501|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.767

gagaaaggcgtggagaaaggcgtggagaca	CRISPR spacer
gcgatgacggtggagaaaggcgtgcagaca	Protospacer
* ** ..  *************** *****

8. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 7, identity: 0.767

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
gcagaaggcgtggagacagacgaggaggct	Protospacer
* ..***************.** ****.* 

9. spacer 16.3|4529985|30|NC_014501|CRT matches to NZ_CP010885 (Vibrio parahaemolyticus strain CHN25 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.767

ttctctagatgattctctagatgagtctct	CRISPR spacer
ggctttagatgattctctagatgcggcatt	Protospacer
  **.****************** * * .*

10. spacer 16.3|4529985|30|NC_014501|CRT matches to NZ_CP007006 (Vibrio parahaemolyticus UCM-V493 plasmid pVPUCMV, complete sequence) position: , mismatch: 7, identity: 0.767

ttctctagatgattctctagatgagtctct	CRISPR spacer
ggctttagatgattctctagatgcggcatt	Protospacer
  **.****************** * * .*

11. spacer 16.3|4529985|30|NC_014501|CRT matches to NZ_CP019298 (Vibrio campbellii strain LMB29 plasmid pLMB96, complete sequence) position: , mismatch: 7, identity: 0.767

ttctctagatgattctctagatgagtctct	CRISPR spacer
ggctttagatgattctctagatgcggcatt	Protospacer
  **.****************** * * .*

12. spacer 1.1|51952|31|NC_014501|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.742

ccctagtatttccccaaccccctccgccgcg	CRISPR spacer
ctcccccctttccccaaccacccccgccgcg	Protospacer
*.*.  . *********** **.********

13. spacer 6.1|927034|30|NC_014501|CRT matches to MK448904 (Streptococcus phage Javan316, complete genome) position: , mismatch: 8, identity: 0.733

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
ttaaagaaatcgctgaggaaatcgctaaaa	Protospacer
. .******** *********** **.*..

14. spacer 6.1|927034|30|NC_014501|CRT matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 8, identity: 0.733

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
agtcatgaatctctgaggaaagctctcagg	Protospacer
 .  * .************** **** ***

15. spacer 6.2|927082|30|NC_014501|CRT matches to MK448904 (Streptococcus phage Javan316, complete genome) position: , mismatch: 8, identity: 0.733

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
ttaaagaaatcgctgaggaaatcgctaaaa	Protospacer
. .******** *********** **.*..

16. spacer 6.2|927082|30|NC_014501|CRT matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 8, identity: 0.733

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
agtcatgaatctctgaggaaagctctcagg	Protospacer
 .  * .************** **** ***

17. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

18. spacer 8.10|1334254|30|NC_014501|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

19. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

20. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

21. spacer 8.10|1334254|30|NC_014501|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

22. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgcggcgtggagacgggcgtggagatc	Protospacer
 .* . ***********.**********. 

23. spacer 8.7|1334098|30|NC_014501|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 9, identity: 0.7

gagaaaggcgtggagaaaggcgtggagaca	CRISPR spacer
gtagaaggcgtggtgaaaggcgtggttcag	Protospacer
* ..********* ***********    .

24. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgctgcgtggagacgggcgtggagatc	Protospacer
 .* .  **********.**********. 

25. spacer 8.10|1334254|30|NC_014501|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgctgcgtggagacgggcgtggagatc	Protospacer
 .* .  **********.**********. 

26. spacer 8.10|1334254|30|NC_014501|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7

gagaaaggcgtggagacaggcgtggagaca	CRISPR spacer
cggtgctgcgtggagacgggcgtggagatc	Protospacer
 .* .  **********.**********. 

27. spacer 6.1|927034|30|NC_014501|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.667

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
actttgaaatttctgaggaaatctctcctc	Protospacer
     *****.***************    

28. spacer 6.2|927082|30|NC_014501|CRT matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 10, identity: 0.667

cagaagaaatctctgaggaaatctctgagg	CRISPR spacer
actttgaaatttctgaggaaatctctcctc	Protospacer
     *****.***************    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1246218 : 1255356 7 uncultured_Caudovirales_phage(20.0%) NA NA
DBSCAN-SWA_2 5961590 : 5975725 12 Bacillus_phage(12.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage