Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014378 Acetohalobium arabaticum DSM 5501, complete sequence 1 crisprs cas14k,csa3,WYL,cas10d,csc2gr7,csc1gr5,cas3,cas4,cas1,cas2,cas6,Cas9_archaeal,RT,cas14j,DinG,DEDDh 0 2 4 0

Results visualization

1. NC_014378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014378_1 892812-893359 TypeI-D,TypeV NA
7 spacers
cas6,cas2,cas1,cas4,cas3,csc1gr5,csc2gr7,cas10d,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014378_1 1.1|892849|37|NC_014378|PILER-CR,CRT 892849-892885 37 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 9711-9747 6 0.838
NC_014378_1 1.8|892850|36|NC_014378|CRISPRCasFinder 892850-892885 36 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 9712-9747 6 0.833
NC_014378_1 1.1|892849|37|NC_014378|PILER-CR,CRT 892849-892885 37 MN693725 Marine virus AFVG_250M494, complete genome 63002-63038 8 0.784

1. spacer 1.1|892849|37|NC_014378|PILER-CR,CRT matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 6, identity: 0.838

tttatttttttaaattaataccattttagtgttgaca	CRISPR spacer
tttatttctttaaattaataccattttaagatagaaa	Protospacer
*******.********************. .* ** *

2. spacer 1.8|892850|36|NC_014378|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 6, identity: 0.833

ttatttttttaaattaataccattttagtgttgaca	CRISPR spacer
ttatttctttaaattaataccattttaagatagaaa	Protospacer
******.********************. .* ** *

3. spacer 1.1|892849|37|NC_014378|PILER-CR,CRT matches to MN693725 (Marine virus AFVG_250M494, complete genome) position: , mismatch: 8, identity: 0.784

tttatttttttaaattaataccattttagtgttgaca--	CRISPR spacer
tttatttttttaaattaattcc--ttttgtattcccttc	Protospacer
******************* **  *** **.**  *   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 466883 : 474701 10 uncultured_Caudovirales_phage(16.67%) transposase NA
DBSCAN-SWA_2 1192809 : 1204070 11 Streptococcus_phage(25.0%) NA NA
DBSCAN-SWA_3 1656206 : 1665151 9 uncultured_Mediterranean_phage(16.67%) protease NA
DBSCAN-SWA_4 2424790 : 2438512 13 Synechococcus_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage