Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_014371 Prevotella melaninogenica ATCC 25845 chromosome II, complete sequence 11 crisprs DEDDh,cas3,PrimPol,csa3 1 1 3 2
NC_014370 Prevotella melaninogenica ATCC 25845 chromosome I, complete sequence 4 crisprs WYL,DEDDh,PD-DExK 0 0 1 0

Results visualization

1. NC_014370
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014370_1 25855-25944 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014370_2 1232798-1232914 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014370_3 1464193-1464289 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014370_4 1574324-1574456 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1223993 : 1232463 9 Catovirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_014371
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_1 206771-206876 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_2 781237-781340 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_3 788674-788827 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_4 1009226-1009316 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_5 1136615-1136751 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_6 1189574-1189684 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_7 1252983-1253073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_8 1345065-1345166 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_9 1347768-1347850 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_10 1353303-1353425 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_014371_11 1364842-1364925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_014371_6 6.1|1189601|57|NC_014371|CRISPRCasFinder 1189601-1189657 57 NC_014371.1 1328682-1328738 0 1.0
NC_014371_6 6.1|1189601|57|NC_014371|CRISPRCasFinder 1189601-1189657 57 NC_014371.1 1328766-1328822 0 1.0

1. spacer 6.1|1189601|57|NC_014371|CRISPRCasFinder matches to position: 1328682-1328738, mismatch: 0, identity: 1.0

acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	CRISPR spacer
acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	Protospacer
*********************************************************

2. spacer 6.1|1189601|57|NC_014371|CRISPRCasFinder matches to position: 1328766-1328822, mismatch: 0, identity: 1.0

acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	CRISPR spacer
acttattgctatataattcgtgtcattcgcgtaattcgcagtcaactttttgattag	Protospacer
*********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 NZ_CP020004 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed2, complete sequence 38937-38965 7 0.759
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 NC_048762 Bacillus phage vB_BtS_B83, complete genome 5072-5100 7 0.759
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 KY290956 Aeromonas phage L9-6, complete genome 93770-93798 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 KY290951 Aeromonas phage 31.2, complete genome 93171-93199 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 NC_005135 Aeromonas phage 44RR2.8t, complete genome 93412-93440 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 AY962392 Aeromonas phage 31, complete genome 93174-93202 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 KY290958 Aeromonas phage SW69-9, complete genome 93306-93334 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 AY375531 Bacteriophage 44RR2.8t, complete genome 93412-93440 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 KY290948 Aeromonas phage 44RR2.8t.2, complete genome 93412-93440 8 0.724
NC_014371_10 10.1|1353350|29|NC_014371|CRISPRCasFinder 1353350-1353378 29 KY290957 Aeromonas phage Riv-10, complete genome 94507-94535 8 0.724

1. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to NZ_CP020004 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.759

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaggaacaagtgtttatgcctc	Protospacer
********* *****.*******     *

2. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to NC_048762 (Bacillus phage vB_BtS_B83, complete genome) position: , mismatch: 7, identity: 0.759

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaggaacaagtgtttatgcctc	Protospacer
********* *****.*******     *

3. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to KY290956 (Aeromonas phage L9-6, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

4. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to KY290951 (Aeromonas phage 31.2, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

5. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to NC_005135 (Aeromonas phage 44RR2.8t, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

6. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to AY962392 (Aeromonas phage 31, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

7. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to KY290958 (Aeromonas phage SW69-9, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

8. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to AY375531 (Bacteriophage 44RR2.8t, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

9. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to KY290948 (Aeromonas phage 44RR2.8t.2, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

10. spacer 10.1|1353350|29|NC_014371|CRISPRCasFinder matches to KY290957 (Aeromonas phage Riv-10, complete genome) position: , mismatch: 8, identity: 0.724

agtaacagatgaacaggtgtttagtggac	CRISPR spacer
agtaacagaagaacaggtgttcgactgca	Protospacer
********* ***********.... *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 174965 : 249051 46 Tupanvirus(18.18%) tRNA,transposase,holin,protease NA
DBSCAN-SWA_2 384378 : 391992 6 Prochlorococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 745907 : 821860 52 Staphylococcus_phage(20.0%) transposase,integrase attL 820038:820052|attR 823360:823374
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_014371.1|WP_013265106.1|912067_912487_-|PcfK-like-family-protein 912067_912487_- 139 aa aa 40 NA NA No NA
NC_014371.1|WP_006256421.1|1093391_1093811_+|PcfK-like-family-protein 1093391_1093811_+ 139 aa aa 40 NA NA No NA