Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011355 Mycobacterium liflandii 128FXT plasmid pMUM002, complete sequence 0 crisprs NA 0 0 1 0
NC_020133 Mycobacterium liflandii 128FXT, complete sequence 19 crisprs cas3,csa3,cas4,WYL,DEDDh,DinG,casR 13 38 0 0

Results visualization

1. NC_011355
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43294 : 164390 16 Paenibacillus_phage(50.0%) integrase,transposase attL 35601:35660|attR 177979:178044

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_020133
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_1 660761-660967 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_2 706234-706752 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_3 906617-907681 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_4 1144649-1145950 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_5 1473673-1473774 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_6 2378284-2379722 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_8 2660723-2660786 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_7 2660426-2660630 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_9 2660876-2661232 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_10 2773049-2773169 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_12 3266661-3266831 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_11 3265714-3265935 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_13 3825022-3825398 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_14 4245512-4246195 Orphan NA
10 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_16 5186643-5186751 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_15 5186064-5186539 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_17 5730001-5730078 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_18 5896530-5897425 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_020133_19 6033086-6033792 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_020133_9 9.5|2661146|15|NC_020133|CRISPRCasFinder 2661146-2661160 15 NC_020133.1 553273-553287 0 1.0
NC_020133_9 9.5|2661146|15|NC_020133|CRISPRCasFinder 2661146-2661160 15 NC_020133.1 2564748-2564762 0 1.0
NC_020133_10 10.1|2773095|29|NC_020133|CRISPRCasFinder 2773095-2773123 29 NC_020133.1 2775909-2775937 0 1.0
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 5958253-5958276 1 0.958
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 2158406-2158424 1 0.947
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 4364130-4364148 1 0.947
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5031255-5031273 1 0.947
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5709458-5709476 1 0.947
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 1850116-1850134 1 0.947
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 1850293-1850311 1 0.947
NC_020133_14 14.17|4246037|22|NC_020133|CRISPRCasFinder 4246037-4246058 22 NC_020133.1 6016631-6016652 1 0.955
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 3632360-3632378 1 0.947
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 5030963-5030981 1 0.947
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 542423-542446 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 1457373-1457396 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 2575315-2575338 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 3264956-3264979 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 3867184-3867207 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 4158847-4158870 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 4365347-4365370 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 4365356-4365379 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 6062946-6062969 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 907664-907687 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 907748-907771 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 907952-907975 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 907961-907984 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 908285-908308 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 2379898-2379921 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NC_020133.1 5718346-5718369 2 0.917
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 457520-457538 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 908685-908703 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 943601-943619 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 943676-943694 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 2562699-2562717 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 3027929-3027947 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 3262918-3262936 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 3359848-3359866 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 3364132-3364150 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5463512-5463530 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5474283-5474301 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5716299-5716317 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5718342-5718360 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5957088-5957106 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5957685-5957703 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 5958072-5958090 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6028822-6028840 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6029209-6029227 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6032927-6032945 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6060585-6060603 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6060912-6060930 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6061239-6061257 2 0.895
NC_020133_6 6.7|2378715|19|NC_020133|CRT 2378715-2378733 19 NC_020133.1 6061566-6061584 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 529383-529401 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 636276-636294 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 2350355-2350373 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 3282589-3282607 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 3718262-3718280 2 0.895
NC_020133_6 6.8|2378769|19|NC_020133|CRT 2378769-2378787 19 NC_020133.1 4921382-4921400 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 132746-132764 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 455778-455796 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 662134-662152 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 1146987-1147005 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 1397316-1397334 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 1848365-1848383 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 2882173-2882191 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 2882299-2882317 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 3262235-3262253 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 3265991-3266009 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 3865747-3865765 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 3865834-3865852 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 3865924-3865942 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 4159321-4159339 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 5380783-5380801 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 5806781-5806799 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 5958387-5958405 2 0.895
NC_020133_6 6.10|2378907|19|NC_020133|CRT 2378907-2378925 19 NC_020133.1 6032423-6032441 2 0.895
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_020133.1 1687973-1687996 2 0.917
NC_020133_14 14.17|4246037|22|NC_020133|CRISPRCasFinder 4246037-4246058 22 NC_020133.1 1704640-1704661 2 0.909
NC_020133_14 14.17|4246037|22|NC_020133|CRISPRCasFinder 4246037-4246058 22 NC_020133.1 4931874-4931895 2 0.909
NC_020133_15 15.5|5186338|23|NC_020133|CRISPRCasFinder 5186338-5186360 23 NC_020133.1 5205817-5205839 2 0.913
NC_020133_15 15.7|5186431|20|NC_020133|CRISPRCasFinder 5186431-5186450 20 NC_020133.1 519557-519576 2 0.9
NC_020133_15 15.7|5186431|20|NC_020133|CRISPRCasFinder 5186431-5186450 20 NC_020133.1 2583083-2583102 2 0.9
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_020133.1 1689414-1689441 2 0.929
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 236389-236407 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 1688264-1688282 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 1689414-1689432 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 2181976-2181994 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 2182063-2182081 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 2380426-2380444 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 2632165-2632183 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 3091243-3091261 2 0.895
NC_020133_18 18.7|5897066|19|NC_020133|CRT 5897066-5897084 19 NC_020133.1 5898224-5898242 2 0.895
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_020133.1 5037106-5037130 2 0.92

1. spacer 9.5|2661146|15|NC_020133|CRISPRCasFinder matches to position: 553273-553287, mismatch: 0, identity: 1.0 

cagcccggcggcggc	CRISPR spacer
cagcccggcggcggc	Protospacer
***************

2. spacer 9.5|2661146|15|NC_020133|CRISPRCasFinder matches to position: 2564748-2564762, mismatch: 0, identity: 1.0 

cagcccggcggcggc	CRISPR spacer
cagcccggcggcggc	Protospacer
***************

3. spacer 10.1|2773095|29|NC_020133|CRISPRCasFinder matches to position: 2775909-2775937, mismatch: 0, identity: 1.0 

taatctgcggagtactgatctgcggaagc	CRISPR spacer
taatctgcggagtactgatctgcggaagc	Protospacer
*****************************

4. spacer 3.14|907637|24|NC_020133|CRT matches to position: 5958253-5958276, mismatch: 1, identity: 0.958 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgctgccgttgccgccgtt	Protospacer
**************** *******

5. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 2158406-2158424, mismatch: 1, identity: 0.947 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtgccgccgtt	Protospacer
************** ****

6. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 4364130-4364148, mismatch: 1, identity: 0.947 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtgccgccgtt	Protospacer
************** ****

7. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5031255-5031273, mismatch: 1, identity: 0.947 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtgccgccgtt	Protospacer
************** ****

8. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5709458-5709476, mismatch: 1, identity: 0.947 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtgccgccgtt	Protospacer
************** ****

9. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 1850116-1850134, mismatch: 1, identity: 0.947 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccgaggccgctgtt	Protospacer
********.**********

10. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 1850293-1850311, mismatch: 1, identity: 0.947 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccgaggccgctgtt	Protospacer
********.**********

11. spacer 14.17|4246037|22|NC_020133|CRISPRCasFinder matches to position: 6016631-6016652, mismatch: 1, identity: 0.955 

gatgttgccgatattgccgctg	CRISPR spacer
gaggttgccgatattgccgctg	Protospacer
** *******************

12. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 3632360-3632378, mismatch: 1, identity: 0.947 

caatgccgggctgctgttc	CRISPR spacer
caatggcgggctgctgttc	Protospacer
***** *************

13. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 5030963-5030981, mismatch: 1, identity: 0.947 

caatgccgggctgctgttc	CRISPR spacer
caacgccgggctgctgttc	Protospacer
***.***************

14. spacer 3.14|907637|24|NC_020133|CRT matches to position: 542423-542446, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

15. spacer 3.14|907637|24|NC_020133|CRT matches to position: 1457373-1457396, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

16. spacer 3.14|907637|24|NC_020133|CRT matches to position: 2575315-2575338, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

17. spacer 3.14|907637|24|NC_020133|CRT matches to position: 3264956-3264979, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

18. spacer 3.14|907637|24|NC_020133|CRT matches to position: 3867184-3867207, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

19. spacer 3.14|907637|24|NC_020133|CRT matches to position: 4158847-4158870, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

20. spacer 3.14|907637|24|NC_020133|CRT matches to position: 4365347-4365370, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

21. spacer 3.14|907637|24|NC_020133|CRT matches to position: 4365356-4365379, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

22. spacer 3.14|907637|24|NC_020133|CRT matches to position: 6062946-6062969, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

23. spacer 3.14|907637|24|NC_020133|CRT matches to position: 907664-907687, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

24. spacer 3.14|907637|24|NC_020133|CRT matches to position: 907748-907771, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

25. spacer 3.14|907637|24|NC_020133|CRT matches to position: 907952-907975, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

26. spacer 3.14|907637|24|NC_020133|CRT matches to position: 907961-907984, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

27. spacer 3.14|907637|24|NC_020133|CRT matches to position: 908285-908308, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

28. spacer 3.14|907637|24|NC_020133|CRT matches to position: 2379898-2379921, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

29. spacer 3.14|907637|24|NC_020133|CRT matches to position: 5718346-5718369, mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

30. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 457520-457538, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

31. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 908685-908703, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgtttccggcgtt	Protospacer
******** * ********

32. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 943601-943619, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggcgccgccgtt	Protospacer
*********.**** ****

33. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 943676-943694, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggcgccgccgtt	Protospacer
*********.**** ****

34. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 2562699-2562717, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtaccgccgtt	Protospacer
**********.*** ****

35. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 3027929-3027947, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgctgccggcatt	Protospacer
******** *******.**

36. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 3262918-3262936, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttcctccggtgccgccgtt	Protospacer
**** ********* ****

37. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 3359848-3359866, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttcctccggtgccgccgtt	Protospacer
**** ********* ****

38. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 3364132-3364150, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

39. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5463512-5463530, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgcctgcgccggcgtt	Protospacer
******* *.*********

40. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5474283-5474301, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggtaccgccgtt	Protospacer
**********.*** ****

41. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5716299-5716317, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

42. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5718342-5718360, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

43. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5957088-5957106, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

44. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5957685-5957703, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggcgccgccgtt	Protospacer
*********.**** ****

45. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 5958072-5958090, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

46. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6028822-6028840, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

47. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6029209-6029227, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggcgccgccgtt	Protospacer
*********.**** ****

48. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6032927-6032945, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccggcgccgccgtt	Protospacer
*********.**** ****

49. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6060585-6060603, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

50. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6060912-6060930, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

51. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6061239-6061257, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

52. spacer 6.7|2378715|19|NC_020133|CRT matches to position: 6061566-6061584, mismatch: 2, identity: 0.895 

ttccgccggtgccggcgtt	CRISPR spacer
ttccgccgttgccgccgtt	Protospacer
******** ***** ****

53. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 529383-529401, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccggctccgccgtt	Protospacer
********* **** ****

54. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 636276-636294, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccagatccgccgtt	Protospacer
*******.****** ****

55. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 2350355-2350373, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccgaatccggcatt	Protospacer
********.*******.**

56. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 3282589-3282607, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccgtctccggcgtt	Protospacer
********  *********

57. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 3718262-3718280, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccggacccgccgtt	Protospacer
**********.*** ****

58. spacer 6.8|2378769|19|NC_020133|CRT matches to position: 4921382-4921400, mismatch: 2, identity: 0.895 

cgccgccggatccggcgtt	CRISPR spacer
cgccgccggttccggcttt	Protospacer
********* ****** **

59. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 132746-132764, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgctgccggggccgttgtt	Protospacer
***.**********.****

60. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 455778-455796, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

61. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 662134-662152, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

62. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 1146987-1147005, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgttgtt	Protospacer
********* ****.****

63. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 1397316-1397334, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

64. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 1848365-1848383, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

65. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 2882173-2882191, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

66. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 2882299-2882317, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

67. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 3262235-3262253, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccggtgtt	Protospacer
********* **** ****

68. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 3265991-3266009, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

69. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 3865747-3865765, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

70. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 3865834-3865852, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccgtt	Protospacer
********* *****.***

71. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 3865924-3865942, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

72. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 4159321-4159339, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccgtggccgccgtt	Protospacer
******** ******.***

73. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 5380783-5380801, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

74. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 5806781-5806799, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgctgccggagccgctgtt	Protospacer
***.*****.*********

75. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 5958387-5958405, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

76. spacer 6.10|2378907|19|NC_020133|CRT matches to position: 6032423-6032441, mismatch: 2, identity: 0.895 

tgccgccggggccgctgtt	CRISPR spacer
tgccgccggcgccgccgtt	Protospacer
********* *****.***

77. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to position: 1687973-1687996, mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagcccaccggagccgccggc	Protospacer
*******.****** *********

78. spacer 14.17|4246037|22|NC_020133|CRISPRCasFinder matches to position: 1704640-1704661, mismatch: 2, identity: 0.909 

gatgttgccgatattgccgctg	CRISPR spacer
gaggttgccgatgttgccgctg	Protospacer
** *********.*********

79. spacer 14.17|4246037|22|NC_020133|CRISPRCasFinder matches to position: 4931874-4931895, mismatch: 2, identity: 0.909 

gatgttgccgatattgccgctg	CRISPR spacer
gatgttgccggtgttgccgctg	Protospacer
**********.*.*********

80. spacer 15.5|5186338|23|NC_020133|CRISPRCasFinder matches to position: 5205817-5205839, mismatch: 2, identity: 0.913 

taacggcgggtctgccgggctgt	CRISPR spacer
taacggtgggtcggccgggctgt	Protospacer
******.***** **********

81. spacer 15.7|5186431|20|NC_020133|CRISPRCasFinder matches to position: 519557-519576, mismatch: 2, identity: 0.9 

tgccggcggcgcgggtggat	CRISPR spacer
tgccggcggagcgggcggat	Protospacer
********* *****.****

82. spacer 15.7|5186431|20|NC_020133|CRISPRCasFinder matches to position: 2583083-2583102, mismatch: 2, identity: 0.9 

tgccggcggcgcgggtggat	CRISPR spacer
tgccggcggagccggtggat	Protospacer
********* ** *******

83. spacer 18.5|5896958|28|NC_020133|CRT matches to position: 1689414-1689441, mismatch: 2, identity: 0.929 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcaacgccgggttgctgttc	Protospacer
**********.********.********

84. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 236389-236407, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caacgccgggctggtgttc	Protospacer
***.********* *****

85. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 1688264-1688282, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caatgccgggttgttgttc	Protospacer
**********.**.*****

86. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 1689414-1689432, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caacgccgggttgctgttc	Protospacer
***.******.********

87. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 2181976-2181994, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caacgccgggttgctgttc	Protospacer
***.******.********

88. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 2182063-2182081, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caacgccggactgctgttc	Protospacer
***.*****.*********

89. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 2380426-2380444, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caaaggcgggctgctgttc	Protospacer
*** * *************

90. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 2632165-2632183, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caatgccggtttgctgttc	Protospacer
********* .********

91. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 3091243-3091261, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
caatgccgggacgctgttc	Protospacer
********** .*******

92. spacer 18.7|5897066|19|NC_020133|CRT matches to position: 5898224-5898242, mismatch: 2, identity: 0.895 

caatgccgggctgctgttc	CRISPR spacer
cagtgccgggctggtgttc	Protospacer
**.********** *****

93. spacer 19.11|6033676|25|NC_020133|CRT matches to position: 5037106-5037130, mismatch: 2, identity: 0.92 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggcggggccggcggcaat	Protospacer
*********.** ************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 100084-100105 1 0.955
NC_020133_15 15.6|5186386|20|NC_020133|CRISPRCasFinder 5186386-5186405 20 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 571938-571957 1 0.95
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211460-2211483 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350124 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350110-350133 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MN304815 Burkholderiales phage 68_11, complete genome 12961-12984 2 0.917
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 KC736071 Mycobacterium phage WIVsmall, complete genome 29692-29715 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 257725-257748 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 398788-398811 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 99448-99471 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 398788-398811 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_012848 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence 755110-755133 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 826515-826538 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 423645-423668 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 380890-380913 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 173829-173852 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 245232-245255 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 1196213-1196236 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_LR723680 Arsenite-oxidising bacterium NT-25 plasmid 4 81378-81401 2 0.917
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_FO082821 Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence 13866-13889 2 0.917
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1629516-1629537 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1692855-1692876 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1703999-1704020 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1547741-1547762 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1718370-1718391 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1748297-1748318 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1779793-1779814 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1924010-1924031 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1400623-1400644 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1679032-1679053 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 291532-291553 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 666460-666481 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2134845-2134866 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1757793-1757814 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1619646-1619667 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 164445-164466 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP023158 Xanthomonas citri pv. malvacearum strain AR81009 plasmid unnamed3, complete sequence 21676-21697 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1465417-1465438 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1700081-1700102 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1716916-1716937 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1546763-1546784 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1616214-1616235 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1616215-1616236 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1694901-1694922 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1763733-1763754 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1547733-1547754 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1547091-1547112 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1547723-1547744 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1637824-1637845 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1694366-1694387 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1769273-1769294 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1763700-1763721 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1673137-1673158 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1748714-1748735 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1762481-1762502 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1659611-1659632 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1673450-1673471 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1748714-1748735 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1762534-1762555 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1673138-1673159 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1629688-1629709 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1660257-1660278 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1672341-1672362 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1748714-1748735 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1748714-1748735 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1748714-1748735 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1762530-1762551 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1762519-1762540 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1659633-1659654 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1673359-1673380 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1629670-1629691 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1654005-1654026 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1715049-1715070 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1747030-1747051 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1746029-1746050 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1762519-1762540 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1659633-1659654 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1673449-1673470 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1763523-1763544 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1659633-1659654 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1659633-1659654 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1762530-1762551 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1748719-1748740 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1762541-1762562 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1762342-1762363 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1629650-1629671 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 951891-951912 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 379486-379507 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 953487-953508 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 144069-144090 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1163704-1163725 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 734963-734984 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 717285-717306 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1353932-1353953 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 283505-283526 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 251356-251377 2 0.909
NC_020133_13 13.3|3825144|22|NC_020133|CRT 3825144-3825165 22 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 251356-251377 2 0.909
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 116886-116910 2 0.92
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1403791-1403815 2 0.92
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 238812-238836 2 0.92
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 302148-302172 2 0.92
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 297269-297293 2 0.92
NC_020133_3 3.11|907478|24|NC_020133|CRT 907478-907501 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 534075-534098 3 0.875
NC_020133_3 3.11|907478|24|NC_020133|CRT 907478-907501 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 534075-534098 3 0.875
NC_020133_3 3.11|907478|24|NC_020133|CRT 907478-907501 24 MN434096 Klebsiella phage JIPh_Kp127, complete genome 87060-87083 3 0.875
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 KU935731 Mycobacterium phage Phrann, complete genome 21144-21167 3 0.875
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MT498061 Mycobacterium phage Jung, complete genome 21957-21980 3 0.875
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MH509447 Microbacterium phage Eden, complete genome 11440-11463 3 0.875
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 KJ410133 Mycobacterium phage Jolie2, complete genome 21774-21797 3 0.875
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MK494099 Mycobacterium phage Typha, complete genome 41894-41917 3 0.875
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 35166-35193 3 0.893
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN585977 Mycobacterium phage Atcoo, complete genome 13801-13828 3 0.893
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 132708-132731 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 133347-133370 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1377851-1377874 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 435225-435248 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 456283-456306 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 130968-130991 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1333394-1333417 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 84841-84864 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 36053-36076 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 157805-157828 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 935524-935547 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 115759-115782 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 592380-592403 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 382864-382887 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 818671-818694 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 7966-7989 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 306992-307015 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 381246-381269 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 244450-244473 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 KX641262 Mycobacterium phage Nazo, complete genome 33313-33336 3 0.875
NC_020133_9 9.3|2661056|24|NC_020133|CRISPRCasFinder 2661056-2661079 24 NC_023692 Mycobacterium phage BigNuz, complete genome 33116-33139 3 0.875
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 168966-168990 3 0.88
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1552438-1552462 3 0.88
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261204-261228 3 0.88
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 KT630646 Salmonella phage SEN5, complete genome 1762-1786 3 0.88
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 KT630645 Salmonella phage SEN4, complete genome 1762-1786 3 0.88
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP022659 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence 2752-2776 3 0.88
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP022659 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence 69197-69221 3 0.88
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 44280-44304 3 0.88
NC_020133_14 14.15|4245857|22|NC_020133|CRISPRCasFinder 4245857-4245878 22 NZ_CP049034 Fluviibacterium aquatile strain SC52 plasmid pSC52_6, complete sequence 49483-49504 3 0.864
NC_020133_14 14.17|4246037|22|NC_020133|CRISPRCasFinder 4246037-4246058 22 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1936111-1936132 3 0.864
NC_020133_14 14.17|4246037|22|NC_020133|CRISPRCasFinder 4246037-4246058 22 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1936289-1936310 3 0.864
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP022419 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence 94493-94521 3 0.897
NC_020133_15 15.5|5186338|23|NC_020133|CRISPRCasFinder 5186338-5186360 23 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1198306-1198328 3 0.87
NC_020133_15 15.5|5186338|23|NC_020133|CRISPRCasFinder 5186338-5186360 23 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2563944-2563966 3 0.87
NC_020133_15 15.5|5186338|23|NC_020133|CRISPRCasFinder 5186338-5186360 23 NZ_CP046906 Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence 49244-49266 3 0.87
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 273791-273818 3 0.893
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209494-2209518 3 0.88
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1552437-1552461 3 0.88
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 362320-362344 3 0.88
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 260828-260852 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP033195 Xanthomonas oryzae pv. oryzae strain CIAT plasmid unnamed, complete sequence 9437-9461 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP034654 Xanthomonas vasicola pv. arecae strain NCPPB 2649 plasmid pXCARECAE29, complete sequence 6238-6262 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83431-83455 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP033202 Xanthomonas oryzae pv. oryzae strain BXO1 plasmid pBXO1-1, complete sequence 17920-17944 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350032-350056 3 0.88
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 294138-294162 3 0.88
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP010166 Escherichia coli strain H2 plasmid C, complete sequence 7771-7794 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP048352 Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence 15633-15656 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 182643-182666 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 192298-192321 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026206 Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence 10130-10153 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MG516909 Escherichia coli plasmid pEc1675, complete sequence 147346-147369 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026404 Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence 113148-113171 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026058 Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence 252977-253000 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP022155 Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence 56135-56158 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026234 Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence 172783-172806 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP026272 Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence 130159-130182 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP022152 Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence 96210-96233 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP041248 Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence 166476-166499 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 11384-11407 4 0.833
NC_020133_3 3.14|907637|24|NC_020133|CRT 907637-907660 24 NZ_CP048383 Citrobacter freundii strain 62 plasmid p6_A, complete sequence 196247-196270 4 0.833
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP023550 Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence 151352-151379 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292927-292954 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 71044-71071 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 153729-153756 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 93270-93297 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 783865-783892 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1526511-1526538 4 0.857
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KP087949 Eel River basin pequenovirus isolate c15773, complete genome 1977-2004 4 0.857
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 MK524502 Microbacterium phage TimoTea, complete genome 10775-10802 4 0.857
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_010683 Ralstonia pickettii 12J plasmid pRPIC01, complete sequence 23181-23208 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1154481-1154508 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 756212-756239 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 295243-295270 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 413467-413494 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK494095 Mycobacterium phage Daegal, complete genome 5960-5987 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 166107-166134 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN096355 Mycobacterium phage Purky, complete genome 13506-13533 4 0.857
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 410456-410483 4 0.857
NC_020133_7 7.3|2660543|24|NC_020133|CRISPRCasFinder 2660543-2660566 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1658754-1658777 4 0.833
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KT347313 Mycobacterium phage Brusacoram, complete genome 37303-37327 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MG198785 Mycobacterium phage Thespis, complete genome 37303-37327 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 504882-504906 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 168000-168024 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF158036 Salmonella phage St161, complete genome 17941-17965 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 275874-275898 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_CP044035 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence 29411-29435 4 0.84
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_013190 Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph02, complete sequence 23420-23444 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP021469 Komagataeibacter europaeus strain SRCM101446 plasmid pKE1446-2, complete sequence 24433-24457 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP018236 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8 135241-135265 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP004364 Komagataeibacter xylinus E25 plasmid pGX4, complete sequence 68286-68310 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP014276 Martelella sp. AD-3 plasmid unnamed1, complete sequence 191549-191573 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 118507-118531 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 207463-207487 4 0.84
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NZ_CP019878 Komagataeibacter nataicola strain RZS01 plasmid pKNA03, complete sequence 12395-12419 4 0.84
NC_020133_14 14.10|4246151|27|NC_020133|CRT 4246151-4246177 27 NZ_CP022209 Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence 196491-196517 4 0.852
NC_020133_14 14.10|4246151|27|NC_020133|CRT 4246151-4246177 27 NZ_CP009321 Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence 140490-140516 4 0.852
NC_020133_14 14.10|4246151|27|NC_020133|CRT 4246151-4246177 27 NZ_CP022007 Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence 67865-67891 4 0.852
NC_020133_14 14.10|4246151|27|NC_020133|CRT 4246151-4246177 27 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 831559-831585 4 0.852
NC_020133_14 14.10|4246151|27|NC_020133|CRT 4246151-4246177 27 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 812857-812883 4 0.852
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_KM017071 Sphingomonas sp. JE1 plasmid pJE1, complete sequence 100668-100695 4 0.857
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MH632120 Mycobacterium phage Thonko, complete genome 30561-30588 4 0.857
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 177127-177154 4 0.857
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP041162 Leisingera aquaemixtae strain R2C4 plasmid unnamed6 26010-26034 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_DQ996271 Burkholderia glumae BGR1 plasmid pBGF3, complete sequence 3806-3830 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 14440-14464 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 643929-643953 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 105593-105617 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP009216 Corynebacterium ureicelerivorans strain IMMIB RIV-2301 plasmid unnamed, complete sequence 23136-23160 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 607577-607601 4 0.84
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NC_010879 Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence 21769-21793 4 0.84
NC_020133_18 18.13|5897381|25|NC_020133|CRT 5897381-5897405 25 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 293213-293237 4 0.84
NC_020133_18 18.13|5897381|25|NC_020133|CRT 5897381-5897405 25 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 276438-276462 4 0.84
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_015728 Roseobacter litoralis Och 149 plasmid pRLO149_83, complete sequence 81662-81689 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN369761 Mycobacterium phage Malthus, complete genome 25039-25066 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KJ944841 Mycobacterium phage Cheetobro, complete genome 25123-25150 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 25115-25142 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KY087992 Mycobacterium phage Mitti, complete genome 25039-25066 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MF140402 Mycobacterium phage Chancellor, complete genome 25126-25153 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MK524485 Mycobacterium phage MissDaisy, complete genome 24881-24908 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 AP018470 Mycobacterium phage Y2 DNA, complete genome 25115-25142 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KT361920 Mycobacterium phage Slarp, complete genome 25126-25153 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MT310882 Mycobacterium phage JF1, complete genome 25115-25142 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 25115-25142 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MF140435 Mycobacterium phage Wintermute, complete genome 25115-25142 4 0.857
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_027365 Mycobacterium virus Fionnbarth, complete genome 25116-25143 4 0.857
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP012886 Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence 165393-165417 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 260636-260660 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 335497-335521 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 341725-341749 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP041652 Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence 88376-88400 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 331024-331048 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 341725-341749 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1192581-1192605 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 341737-341761 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 341758-341782 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 341724-341748 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 335524-335548 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 335523-335547 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 335518-335542 4 0.84
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 123688-123712 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 82873-82897 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 491788-491812 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 303654-303678 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_047756 Caulobacter phage Sansa, complete genome 21486-21510 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 213537-213561 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP030179 Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence 73741-73765 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 655034-655058 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP030170 Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence 72229-72253 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP049159 Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence 461137-461161 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP045329 Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence 43732-43756 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP030162 Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence 121309-121333 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP030160 Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence 3386-3410 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 93128-93152 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP018464 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence 134394-134418 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP045345 Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence 361865-361889 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP045335 Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence 334374-334398 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP030165 Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence 22152-22176 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP030165 Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence 144284-144308 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP020696 Sulfitobacter sp. D7 plasmid p2SUD7, complete sequence 98048-98072 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP049320 Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence 13290-13314 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1050555-1050579 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 258699-258723 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1738194-1738218 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 237072-237096 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP030167 Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence 2906-2930 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 652468-652492 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 769349-769373 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 562080-562104 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 661707-661731 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 13365-13389 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 860858-860882 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1698060-1698084 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 1846-1870 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 1843-1867 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 MN694606 Marine virus AFVG_250M830, complete genome 17053-17077 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 AP018462 Mycobacterium phage D12 DNA, complete genome 30937-30961 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 AP018463 Mycobacterium phage PR DNA, complete genome 30914-30938 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 AY616033 Burkholderia cenocepacia phage BcepB1A, complete genome 36290-36314 4 0.84
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 KX443696 Mycobacterium phage Laurie, complete genome 33118-33142 4 0.84
NC_020133_4 4.15|1145837|27|NC_020133|CRT 1145837-1145863 27 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 251311-251337 5 0.815
NC_020133_4 4.15|1145837|27|NC_020133|CRT 1145837-1145863 27 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 21896-21922 5 0.815
NC_020133_4 4.15|1145837|27|NC_020133|CRT 1145837-1145863 27 NZ_CP019241 Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1 11225-11251 5 0.815
NC_020133_4 4.15|1145837|27|NC_020133|CRT 1145837-1145863 27 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 106198-106224 5 0.815
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350097-350124 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350106-350133 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 AJ304453 Uncultured bacterium plasmid pSB102 complete genome 18797-18824 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP018476 Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence 4976-5003 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP018476 Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence 61081-61108 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 592360-592387 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 553920-553947 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP047184 Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence 18422-18449 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK494099 Mycobacterium phage Typha, complete genome 41890-41917 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 102139-102166 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP047181 Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence 48787-48814 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 51806-51833 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 700711-700738 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU935731 Mycobacterium phage Phrann, complete genome 21144-21171 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_026598 Mycobacterium phage Milly, complete genome 4780-4807 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MT498061 Mycobacterium phage Jung, complete genome 21957-21984 5 0.821
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 289184-289211 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1292621-1292648 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1292628-1292655 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1219568-1219595 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1166146-1166173 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 83216-83243 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 94220-94247 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 105225-105252 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 240931-240958 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 44509-44536 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 JN106167 Uncultured bacterium plasmid pAKD16, complete sequence 54435-54462 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 479162-479189 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 418520-418547 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 626012-626039 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 486190-486217 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1701961-1701988 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP024936 Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence 211193-211220 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 150330-150357 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 289050-289077 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 444347-444374 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 537698-537725 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 111304-111331 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1326883-1326910 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 576386-576413 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 183292-183319 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 106882-106909 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 577866-577893 5 0.821
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 42491-42518 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1270740-1270767 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 542798-542825 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 493185-493212 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 833395-833422 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 434559-434586 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 274167-274194 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP013299 Arthrobacter sp. YC-RL1 plasmid unnamed 2, complete sequence 47026-47053 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 121532-121559 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 106759-106786 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 106115-106142 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 467738-467765 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 61271-61298 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP014508 Burkholderia sp. PAMC 28687 plasmid 1, complete sequence 64710-64737 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 121532-121559 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 106157-106184 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 106115-106142 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 144095-144122 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP038032 Rhodococcus ruber strain R1 plasmid unnamed2, complete sequence 11416-11443 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT024866 Mycobacterium phage Willsammy, complete genome 13818-13845 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN892486 Mycobacterium phage KilKor, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN945904 Mycobacterium phage Eponine, complete genome 16478-16505 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN908683 Mycobacterium phage StressBall, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN892484 Mycobacterium phage CactusJack, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT498061 Mycobacterium phage Jung, complete genome 13849-13876 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN807249 Mycobacterium phage Megiddo, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_026605 Mycobacterium phage Malithi, complete genome 13848-13875 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN807250 Mycobacterium phage Glaske, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 KX621007 Mycobacterium phage Taquito, complete genome 16200-16227 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MH051258 Mycobacterium phage SamScheppers, complete genome 16128-16155 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN807248 Mycobacterium phage Phalm, complete genome 13811-13838 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 46945-46972 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 36364-36391 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 808823-808850 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 6644-6671 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 157953-157980 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP052758 Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence 1997-2024 5 0.821
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_049823 Escherichia phage herni, complete genome 2282-2309 5 0.821
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF919525 Mycobacterium phage Murica, complete genome 60081-60105 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF668281 Mycobacterium phage RitaG, complete genome 42463-42487 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH000607 Mycobacterium phage RiverMonster, complete genome 59138-59162 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK967397 Mycobacterium phage Mahavrat, complete genome 42078-42102 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH669010 Mycobacterium phage PHappiness, complete genome 42118-42142 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK757445 Mycobacterium phage Lilizi, complete genome 58749-58773 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH576953 Mycobacterium phage Hopey, complete genome 59521-59545 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF919506 Mycobacterium phage FireRed, complete genome 59397-59421 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 AY129331 Mycobacterium virus Cjw1, complete genome 60171-60195 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN586043 Mycobacterium phage Buck, complete genome 59847-59871 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH697583 Mycobacterium phage EricMillard, complete genome 79292-79316 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN096364 Mycobacterium phage Tomaszewski, complete genome 58531-58555 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KY549152 Mycobacterium phage Maxxinista, complete genome 58850-58874 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF190168 Mycobacterium phage Spoonbill, complete genome 42423-42447 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 JF937090 Mycobacterium virus BAKA, complete genome 79655-79679 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_004688 Mycobacterium phage Omega, complete genome 80522-80546 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF919524 Mycobacterium phage MISSy, complete genome 58865-58889 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 EU816588 Mycobacterium phage Porky, complete genome 57950-57974 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MT952854 Mycobacterium phage Miniwave, complete genome 58360-58384 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK016502 Mycobacterium phage Pat3, complete genome 57561-57585 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 JF937106 Mycobacterium phage SirDuracell, complete genome 58076-58100 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KC748969 Mycobacterium phage Phaux, complete genome 59966-59990 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH669002 Mycobacterium phage Emmina, complete genome 57942-57966 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 AY129338 Mycobacterium virus Omega, complete genome 80522-80546 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH590596 Mycobacterium phage Mantra, complete genome 43286-43310 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KC661277 Mycobacterium phage Phrux, complete genome 58242-58266 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 JF937096 Mycobacterium phage Henry, complete genome 58564-58588 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH669001 Mycobacterium phage EleanorGeorge, complete genome 44081-44105 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH020247 Mycobacterium phage MPhalcon, complete genome 58858-58882 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 JN391441 Mycobacterium phage Elph10, complete genome 58201-58225 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH632119 Mycobacterium phage Harley, complete genome 43786-43810 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_022969 Mycobacterium phage PhatBacter, complete genome 59397-59421 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN586019 Mycobacterium phage Stark, complete genome 59021-59045 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK279849 Mycobacterium phage Duke13, complete genome 77940-77964 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK016491 Mycobacterium phage BaboJay, complete genome 59484-59508 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_028906 Mycobacterium phage Toto, complete genome 59259-59283 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KY319168 Mycobacterium phage CrystalP, complete genome 59259-59283 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KF562100 Mycobacterium phage HufflyPuff, complete genome 59605-59629 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MF919512 Mycobacterium phage Klein, complete genome 78430-78454 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 HQ728524 Mycobacterium phage Wee, complete genome 47491-47515 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH727557 Mycobacterium phage Paperbeatsrock, complete genome 59038-59062 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KF279417 Mycobacterium phage Quink, complete genome 59617-59641 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH669005 Mycobacterium phage JoeyJr, complete genome 42342-42366 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN586044 Mycobacterium phage Rimmer, complete genome 58672-58696 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN586017 Mycobacterium phage OrionPax, complete genome 58455-58479 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 KT020852 Mycobacterium phage NoSleep, complete genome 58383-58407 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK875792 Mycobacterium phage Polka14, complete genome 43182-43206 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_022976 Mycobacterium phage Nala, complete genome 59367-59391 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_021305 Mycobacterium phage Murphy, complete genome 59201-59225 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_022068 Mycobacteriophage Daenerys, complete genome 42174-42198 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 JF937093 Mycobacterium virus DLane, complete genome 45368-45392 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MN586034 Mycobacterium phage Hoonter, complete genome 59015-59039 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_025433 Mycobacteriophage Taj, complete genome 47415-47439 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_004681 Mycobacterium phage Cjw1, complete genome 60171-60195 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MK494116 Mycobacterium phage Dulcie, complete genome 40414-40438 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 MH001458 Mycobacterium phage Smeagol, complete genome 41855-41879 5 0.8
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NC_031067 Mycobacterium phage Makemake, complete genome 41083-41107 5 0.8
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 584896-584920 5 0.8
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 MK059749 Mycobacterium phage CRB2, complete genome 56694-56718 5 0.8
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1200124-1200151 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 709425-709452 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 948055-948082 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1200124-1200151 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 371592-371619 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1180091-1180118 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 417269-417296 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 637628-637655 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 708762-708789 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP035000 Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence 390650-390677 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP043045 Gluconobacter thailandicus strain HD924 plasmid unnamed2, complete sequence 70042-70069 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 478348-478375 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 392109-392136 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 451058-451085 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 276421-276448 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 354869-354896 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_024957 Methylibium sp. T29 plasmid pT29A, complete sequence 60111-60138 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_024958 Methylibium sp. T29-B plasmid pT29B, complete sequence 49977-50004 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 345767-345794 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MH509446 Gordonia phage DelRio, complete genome 24493-24520 5 0.821
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_018580 Gordonia sp. KTR9 plasmid pGKT2, complete sequence 103182-103209 5 0.821
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 878666-878690 5 0.8
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2430240-2430264 5 0.8
NC_020133_18 18.9|5897162|25|NC_020133|CRT 5897162-5897186 25 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 2216017-2216041 5 0.8
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP015738 Shinella sp. HZN7 plasmid pShin-02, complete sequence 37040-37067 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 128575-128602 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 261709-261736 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 184925-184952 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 187283-187310 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 248232-248259 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 15806-15833 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 695652-695679 5 0.821
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1203621-1203648 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP049042 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence 66544-66571 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP015419 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence 71899-71926 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP015422 Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence 71799-71826 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 575221-575248 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP045391 Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence 37338-37365 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP045363 Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence 4766-4793 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP045388 Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence 30790-30817 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 348154-348181 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_AP014803 Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351 56937-56964 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 285619-285646 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 140588-140615 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 DI373491 KR 1020130142837-A/5: Bacteriophage of Pseudomonas aeruginosa and uses thereof 3552-3579 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 JX131330 Pseudomonas phage MP1412, complete genome 27899-27926 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_010116 Pseudomonas phage YuA, complete genome 27427-27454 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MH791406 UNVERIFIED: Pseudomonas phage PaSz-4, complete genome 35241-35268 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_028980 Pseudomonas phage PAE1, complete genome 56539-56566 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MF490239 Pseudomonas phage vB_PaeS_S218, complete genome 36624-36651 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 DQ163916 Bacteriophage M6, complete genome 57322-57349 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KX198613 Pseudomonas phage AN14, complete genome 53019-53046 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KC758116 Pseudomonas phage LKO4, complete genome 28723-28750 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_007809 Pseudomonas phage M6, complete genome 57322-57349 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 265831-265858 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871482 UNVERIFIED: Pseudomonas virus PaSz-6, complete genome 26891-26918 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871486 UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome 10319-10346 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MH791403 UNVERIFIED: Pseudomonas phage PaTs-2, complete genome 25103-25130 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871463 UNVERIFIED: Pseudomonas phage Pa-L, complete genome 1274-1301 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871456 UNVERIFIED: Pseudomonas phage Pa-C, complete genome 24546-24573 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871469 UNVERIFIED: Pseudomonas phage Pa-S, complete genome 25127-25154 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MN871478 UNVERIFIED: Pseudomonas phage PaSt-2_45_61k, complete genome 25103-25130 5 0.821
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MT118302 Pseudomonas phage Epa38, complete genome 60120-60147 5 0.821
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 29895-29919 5 0.8
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 469250-469274 5 0.8
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 484812-484836 5 0.8
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 585846-585870 5 0.8
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 944669-944693 5 0.8
NC_020133_19 19.11|6033676|25|NC_020133|CRT 6033676-6033700 25 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 797790-797814 5 0.8
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1430538-1430570 6 0.818
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4571815-4571842 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4863686-4863713 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 145604-145631 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 2057072-2057099 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_010851 Streptomyces sp. FR1 plasmid pFRL1, complete sequence 12346-12373 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_023282 Streptomyces sp. FR1 plasmid pFRL2, complete sequence 46865-46892 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022578 Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence 125728-125755 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KT221034 Streptomyces phage SF3, complete genome 21367-21394 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KT221033 Streptomyces phage SF1, complete genome 39067-39094 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 588617-588644 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1540825-1540852 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 120226-120253 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1611741-1611768 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 168530-168557 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP016879 Xanthomonas hortorum strain B07-007 plasmid pB07007, complete sequence 23487-23514 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1617546-1617573 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1789728-1789755 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1915586-1915613 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1536376-1536403 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP022268 Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence 59230-59257 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP022269 Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plB, complete sequence 31947-31974 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1399513-1399540 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1619192-1619219 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1328840-1328867 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1549100-1549127 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1579373-1579400 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1543916-1543943 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1503549-1503576 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1543404-1543431 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1630672-1630699 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1629073-1629100 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1617585-1617612 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1531283-1531310 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1629073-1629100 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1531929-1531956 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1629073-1629100 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1629073-1629100 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1629073-1629100 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1531305-1531332 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1536782-1536809 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1517430-1517457 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1570379-1570406 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1609578-1609605 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1626388-1626415 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1531305-1531332 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1637979-1638006 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1531305-1531332 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1531305-1531332 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1629076-1629103 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KC736071 Mycobacterium phage WIVsmall, complete genome 29688-29715 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KC787101 Mycobacterium phage 33D, partial genome 43600-43627 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1094541-1094568 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1122626-1122653 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 531426-531453 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 279904-279931 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_LR134466 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence 41595-41622 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 232544-232571 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 399284-399311 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1126223-1126250 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1613765-1613792 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 852857-852884 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_017553 Pantoea ananatis PA13 plasmid PAGR_p, complete sequence 195403-195430 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 761174-761201 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1496390-1496417 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 761174-761201 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 593671-593698 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 761175-761202 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 593671-593698 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 593671-593698 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 593675-593702 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 422095-422122 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 593671-593698 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 761171-761198 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 416148-416175 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 761177-761204 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 416148-416175 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP018733 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.2, complete sequence 49557-49584 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH727545 Mycobacterium phage DismalStressor, complete genome 4780-4807 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 AF068845 Mycobacteriophage TM4, complete genome 4802-4829 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KX688047 Mycobacterium phage Marcoliusprime, complete genome 4780-4807 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MF140408 Mycobacterium phage DismalFunk, complete genome 4780-4807 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KJ410133 Mycobacterium phage Jolie2, complete genome 21774-21801 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_003387 Mycobacterium phage TM4, complete genome 4802-4829 6 0.786
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 JX042579 Mycobacterium virus MacnCheese, complete genome 24853-24880 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 62930-62957 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 699663-699690 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 144732-144759 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 582628-582655 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 1256-1283 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 MN694768 Marine virus AFVG_250M955, complete genome 2052-2079 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 223032-223059 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2564274-2564301 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 180931-180958 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1193425-1193452 6 0.786
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 268702-268729 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1706841-1706868 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 218733-218760 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2181685-2181712 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 107784-107811 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MF919496 Mycobacterium phage Cerulean, complete genome 25371-25398 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 HM152766 Mycobacterium phage Eagle, complete genome 25056-25083 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MF919498 Mycobacterium phage Cindaradix, complete genome 24777-24804 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 JN699015 Mycobacterium virus LHTSCC, complete genome 25370-25397 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MH651170 Mycobacterium phage ChampagnePapi, complete genome 25370-25397 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_023577 Mycobacterium phage Obama12, complete genome 25372-25399 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK878895 Mycobacterium phage SheldonCooper, complete genome 25371-25398 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 162928-162955 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687350-687377 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP024309 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence 313232-313259 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677366-677393 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK816297 Pseudomonas virus PBPA162, complete genome 33163-33190 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_DQ996271 Burkholderia glumae BGR1 plasmid pBGF3, complete sequence 15025-15052 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 404059-404086 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP039632 Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence 21648-21675 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP039632 Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence 171696-171723 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP015740 Shinella sp. HZN7 plasmid pShin-04, complete sequence 180331-180358 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 29970-29997 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP021919 Sagittula sp. P11 plasmid unnamed5, complete sequence 17552-17579 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 72452-72479 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 LT635659 Aeromonas veronii plasmid 9716_6_27, strain 9716_6_27 3117-3144 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 343198-343225 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 67770-67797 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT889397 Mycobacterium phage OfUltron, complete genome 25180-25207 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT889396 Mycobacterium phage Seabastian, complete genome 25180-25207 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MG872843 Mycobacterium phage Sotrice96, complete genome 27329-27356 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT723943 Mycobacterium phage Cactus, complete genome 26586-26613 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MG872831 Mycobacterium phage Asriel, complete genome 26236-26263 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MF919506 Mycobacterium phage FireRed, complete genome 27396-27423 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT133562 Pseudomonas phage willy, complete genome 18851-18878 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT491206 Pseudomonas phage vB_PaeM_USP_3, complete genome 19159-19186 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT491205 Pseudomonas phage vB_PaeM_USP_2, complete genome 18916-18943 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MH399778 Mycobacterium phage Icee, complete genome 27033-27060 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT119368 Pseudomonas phage shane, complete genome 18783-18810 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK016502 Mycobacterium phage Pat3, complete genome 26094-26121 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 JF937106 Mycobacterium phage SirDuracell, complete genome 26040-26067 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 LC472881 Pseudomonas phage R12 DNA, complete genome 61687-61714 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MH669002 Mycobacterium phage Emmina, complete genome 27196-27223 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 KR080204 Mycobacterium phage Mindy, complete genome 27152-27179 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MG872832 Mycobacterium phage Barbarian, complete genome 26236-26263 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN586032 Mycobacterium phage Command613, complete genome 27642-27669 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 JF937096 Mycobacterium phage Henry, complete genome 27373-27400 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK937593 Mycobacterium phage Flypotenuse, complete genome 26972-26999 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN586013 Mycobacterium phage Traaww1, complete genome 27013-27040 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_026585 Mycobacteriophage Estave1, complete genome 22676-22703 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_022969 Mycobacterium phage PhatBacter, complete genome 27396-27423 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_041850 Mycobacterium phage Eureka, complete genome 27359-27386 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_028906 Mycobacterium phage Toto, complete genome 27374-27401 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 KY319168 Mycobacterium phage CrystalP, complete genome 27374-27401 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN428051 Mycobacterium phage Modragons, complete genome 25024-25051 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK318076 Pseudomonas phage vB_PaeM_fHoPae01, complete genome 26753-26780 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MH536820 Mycobacterium phage Glexan, complete genome 26972-26999 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_028923 Mycobacterium phage Llama, complete genome 25180-25207 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 JF937091 Mycobacterium phage Bask21, complete genome 26553-26580 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MK801726 Mycobacterium phage ChotaBhai, complete genome 26614-26641 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 JN382248 Mycobacterium phage Lilac, complete genome 26865-26892 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_028785 Mycobacterium phage NelitzaMV, complete genome 27443-27470 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT491204 Pseudomonas phage vB_PaeM_USP_1, complete genome 18871-18898 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_022976 Mycobacterium phage Nala, complete genome 27394-27421 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 EU816591 Mycobacterium phage Kostya, complete genome 27373-27400 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_042080 Pseudomonas phage vB_PaeM_E215, complete genome 6645-6672 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_022085 Mycobacterium phage Goku, complete genome 27088-27115 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP024895 Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence 82083-82110 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 730078-730105 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 395268-395295 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 110460-110487 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 267727-267754 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 58776-58803 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MN234171 Mycobacterium phage Magpie, complete genome 31614-31641 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 KX589269 Mycobacterium phage Fortunato, complete genome 31770-31797 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT639648 Mycobacterium phage Heath, complete genome 31372-31399 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_042035 Mycobacterium phage Zemanar, complete sequence 31774-31801 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_022331 Mycobacterium phage Bane1, complete genome 31447-31474 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 KF279413 Mycobacterium phage Bane2, complete genome 31426-31453 6 0.786
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 MT310870 Mycobacterium phage RawrgerThat, complete genome 31773-31800 6 0.786
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 CP027674 Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence 31024-31048 6 0.76
NC_020133_13 13.2|3825099|25|NC_020133|CRT 3825099-3825123 25 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 147759-147783 6 0.76
NC_020133_13 13.6|3825294|25|NC_020133|CRT 3825294-3825318 25 NC_013531 Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence 11076-11100 6 0.76
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 269307-269338 6 0.812
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 2339-2366 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1040287-1040314 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018469 Xanthomonas vesicatoria strain LM159 plasmid pLM159.3, complete sequence 35673-35700 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017192 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_2, complete sequence 22355-22382 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 214680-214707 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 549305-549332 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020986 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6992 plasmid pA, complete sequence 3967-3994 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020986 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6992 plasmid pA, complete sequence 61037-61064 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1342639-1342666 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018857 Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence 26766-26793 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 CP030168 Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed2, complete sequence 50066-50093 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 470622-470649 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP021017 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pA, complete sequence 23774-23801 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020982 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6989 plasmid pA, complete sequence 32602-32629 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012061 Xanthomonas sp. ISO98C4 plasmid pNX59, complete sequence 42968-42995 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020990 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6996R plasmid pA, complete sequence 48978-49005 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018730 Xanthomonas gardneri strain JS749-3 plasmid pJS749-3.2, complete sequence 6751-6778 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020980 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6988R plasmid pA, complete sequence 21581-21608 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012058 Xanthomonas phaseoli pv. phaseoli strain ISO98C12 plasmid pXap59, complete sequence 42969-42996 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012064 Xanthomonas phaseoli pv. phaseoli strain ISO18C8 plasmid pXap59, complete sequence 42970-42997 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012049 Xanthomonas phaseoli pv. phaseoli strain ISO18C2 plasmid pXap59, complete sequence 42970-42997 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 AP019683 Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome 8545-8572 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 AP019683 Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome 44262-44289 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018727 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence 21581-21608 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MT498043 Arthrobacter phage Jinkies, complete genome 26925-26952 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018474 Xanthomonas perforans strain LH3 plasmid pLH3.3, complete sequence 27503-27530 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 CP020972 Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pA, complete sequence 19435-19462 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017325 Xanthomonas campestris pv. campestris str. CN15 plasmid unnamed1, complete sequence 8142-8169 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017325 Xanthomonas campestris pv. campestris str. CN15 plasmid unnamed1, complete sequence 57242-57269 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018465 Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.4, complete sequence 3840-3867 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP031608 Xanthomonas hortorum strain VT106 plasmid pVT106, complete sequence 11045-11072 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020984 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6990 plasmid pA, complete sequence 1679-1706 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020984 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6990 plasmid pA, complete sequence 58748-58775 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 1026201-1026228 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018853 Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.3, complete sequence 41831-41858 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP034656 Xanthomonas campestris pv. musacearum NCPPB 4379 plasmid pXCM49, complete sequence 26651-26678 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP034656 Xanthomonas campestris pv. musacearum NCPPB 4379 plasmid pXCM49, complete sequence 40851-40878 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020968 Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pA, complete sequence 24325-24352 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_LN811400 Xanthomonas campestris pv. campestris isolate B-1459 plasmid I, complete sequence 2304-2331 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP021019 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pA, complete sequence 45328-45355 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP021022 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence 25368-25395 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 716221-716248 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017318 Xanthomonas campestris pv. campestris str. CN14 plasmid unnamed, complete sequence 31467-31494 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017318 Xanthomonas campestris pv. campestris str. CN14 plasmid unnamed, complete sequence 43817-43844 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP023160 Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed1, complete sequence 12062-12089 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_007506 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence 2313-2340 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP017023 Xanthomonas citri pv. malvacearum strain MSCT plasmid pMSCT60kb, complete sequence 15306-15333 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_020798 Xanthomonas axonopodis Xac29-1 plasmid pXAC47, complete sequence 6375-6402 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020988 Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6994R plasmid pA, complete sequence 10885-10912 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018734 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence 16480-16507 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP018734 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence 29876-29903 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_010879 Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence 6160-6187 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_019397 Gluconobacter oxydans H24 plasmid, complete sequence 110843-110870 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 541846-541873 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 73385-73412 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 342304-342331 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 99704-99731 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 383937-383964 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 427804-427831 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP014690 Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence 230530-230557 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 145283-145310 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 AP014351 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C3, *** SEQUENCING IN PROGRESS *** 11012-11039 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 69778-69805 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 183861-183888 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 562049-562076 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 26581-26608 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 120477-120504 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 62826-62853 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 19810-19837 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_023600 Mycobacterium phage Jolie1, complete genome 42100-42127 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 KJ433975 Mycobacterium phage 40BC, complete genome 42134-42161 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 KJ433973 Mycobacterium phage 39HC, complete genome 42134-42161 6 0.786
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_024145 Mycobacterium phage Hosp, complete genome 40326-40353 6 0.786
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 146851-146884 6 0.824
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 131484-131517 6 0.824
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580704-580737 6 0.824
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 736596-736623 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 457478-457505 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 362391-362418 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 467649-467676 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 1239451-1239478 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP033874 Caulobacter sp. FWC26 plasmid p2 42826-42853 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 680970-680997 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 553472-553499 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 120764-120791 6 0.786
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 933785-933812 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 CP021131 Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence 253430-253457 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP016441 Bordetella pseudohinzii strain HI4681 plasmid unnamed1, complete sequence 19345-19372 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 59145-59172 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 41929-41956 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 791654-791681 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 137455-137482 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 995360-995387 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 134366-134393 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1117758-1117785 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 446992-447019 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP010760 Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence 110754-110781 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP010603 Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence 110760-110787 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP010709 Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence 110755-110782 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1153760-1153787 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP041043 Paracoccus sp. AK26 plasmid pAK3, complete sequence 127605-127632 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 333209-333236 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_011041 Escherichia coli bacteriophage rv5, complete sequence 104849-104876 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_022323 Escherichia phage 2 JES-2013, complete genome 103537-103564 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MG065635 UNVERIFIED: Campylobacter phage C12, complete genome 491-518 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MH491969 Escherichia phage LL12, complete genome 104810-104837 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KP869103 Escherichia coli O157 typing phage 5, complete genome 129696-129723 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KP869102 Escherichia coli O157 typing phage 4, partial genome 18137-18164 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 KJ190158 Escherichia phage vB_EcoM_FFH2, complete genome 105226-105253 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MG065653 UNVERIFIED: Campylobacter phage C14, complete genome 77387-77414 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 35543-35570 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 978619-978646 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MK524525 Mycobacterium phage Ringer, complete genome 28953-28980 6 0.786
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 MH752840 Escherichia phage vB_EcoM-Pr121LW, complete genome 557-584 6 0.786
NC_020133_19 19.8|6033514|25|NC_020133|CRT 6033514-6033538 25 MT664984 Xanthomonas phage Xp12, complete genome 21856-21880 6 0.76
NC_020133_2 2.8|706693|36|NC_020133|CRISPRCasFinder 706693-706728 36 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 333872-333907 7 0.806
NC_020133_3 3.11|907478|24|NC_020133|CRT 907478-907501 24 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 83149-83172 7 0.708
NC_020133_3 3.13|907580|36|NC_020133|CRT 907580-907615 36 NZ_CP024428 Paracoccus yeei strain TT13 plasmid pTT13-6, complete sequence 12623-12658 7 0.806
NC_020133_3 3.13|907580|36|NC_020133|CRT 907580-907615 36 NZ_CP020446 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed6, complete sequence 41421-41456 7 0.806
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1343200-1343232 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 399127-399159 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 885390-885422 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1845457-1845489 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1034153-1034185 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 780459-780491 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 247171-247203 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 530004-530036 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1710682-1710714 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1580622-1580654 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1034261-1034293 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 687677-687709 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1375972-1376004 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 841984-842016 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1756196-1756228 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1219977-1220009 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1033946-1033978 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1746121-1746153 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 852911-852943 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 699008-699040 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 228662-228694 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1033892-1033924 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 673502-673534 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1866649-1866681 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 803082-803114 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 228436-228468 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1419192-1419224 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 273495-273527 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 661712-661744 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1848751-1848783 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 661712-661744 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1848751-1848783 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1320148-1320180 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1459387-1459419 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1287741-1287773 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 227321-227353 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1414592-1414624 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1376229-1376261 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1241884-1241916 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1891387-1891419 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 404476-404508 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1363910-1363942 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 229955-229987 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1371194-1371226 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 291338-291370 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1414560-1414592 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1542733-1542765 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 383392-383424 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1118792-1118824 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1957791-1957823 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1155233-1155265 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1414599-1414631 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1666548-1666580 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 185952-185984 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1287712-1287744 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 230900-230932 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1792828-1792860 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 82396-82428 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 1371367-1371399 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 231214-231246 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1305234-1305266 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1478520-1478552 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 160039-160071 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 1080160-1080192 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 238249-238281 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1293833-1293865 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 228407-228439 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1330643-1330675 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 119732-119764 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1240981-1241013 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1283559-1283591 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1283550-1283582 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1290558-1290590 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 227540-227572 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1481901-1481933 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1241876-1241908 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1241231-1241263 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1241867-1241899 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1257762-1257794 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 224279-224311 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 1382830-1382862 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 231231-231263 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1481868-1481900 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1345778-1345810 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 245635-245667 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 1382077-1382109 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1480662-1480694 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1371179-1371211 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1281236-1281268 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1345778-1345810 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 245635-245667 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 1382077-1382109 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1333215-1333247 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1145144-1145176 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1480698-1480730 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1345778-1345810 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 245635-245667 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1278834-1278866 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1320287-1320319 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1281258-1281290 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1345782-1345814 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 245635-245667 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 1382077-1382109 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 1382077-1382109 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 1382077-1382109 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1480698-1480730 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1480687-1480719 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1281258-1281290 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 1288096-1288128 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 238232-238264 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1320270-1320302 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 1268757-1268789 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 238208-238240 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 1321622-1321654 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 234834-234866 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 1361761-1361793 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 232974-233006 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1480687-1480719 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1281258-1281290 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1345777-1345809 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 245635-245667 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1481689-1481721 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1281258-1281290 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1281258-1281290 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 223322-223354 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1480698-1480730 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 1382080-1382112 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 229925-229957 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1480709-1480741 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1480510-1480542 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 244023-244055 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1320256-1320288 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 419277-419309 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 214446-214478 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 1195124-1195156 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 214446-214478 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 618661-618693 7 0.788
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 214571-214603 7 0.788
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2211460-2211487 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 221445-221472 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 CP003951 Rhodococcus opacus PD630 plasmid 2, complete sequence 40578-40605 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_AP014803 Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351 50861-50888 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH338241 Mycobacterium phage Tarynearal, complete genome 23685-23712 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 142814-142841 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 41784-41811 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 559363-559390 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1658067-1658094 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 27835-27862 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021832 Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence 20193-20220 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 440082-440109 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP026529 Sinorhizobium meliloti strain AK21 plasmid pSmeAK21b, complete sequence 182295-182322 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK878898 Gordonia phage Zameen, complete genome 43857-43884 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK919483 Gordonia phage Suscepit, complete genome 43858-43885 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK112547 Gordonia phage Maridalia, complete genome 45235-45262 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK820642 Gordonia phage Polly, complete genome 43300-43327 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK814755 Gordonia phage Antonio, complete genome 43857-43884 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK875796 Gordonia phage Tayonia, complete genome 43857-43884 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MT521999 Gordonia Phage Jablanski, complete genome 47672-47699 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU963257 Gordonia phage Kita, complete genome 43866-43893 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP021360 Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence 36367-36394 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1620822-1620849 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_017805 Deinococcus gobiensis I-0 plasmid P1, complete sequence 276789-276816 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KT783672 Arthrobacter phage TymAbreu, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MF140420 Arthrobacter phage Mariposa, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576951 Arthrobacter phage Copper, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576955 Arthrobacter phage Hunnie, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KT355475 Arthrobacter phage Sandman, complete genome 12346-12373 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KX576642 Arthrobacter phage Massimo, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KX610765 Arthrobacter phage Prospero, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160670 Arthrobacter phage Toulouse, complete genome 12067-12094 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NC_028692 Arthrobacter phage Decurro, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MN813695 Arthrobacter phage LouisXIV, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576950 Arthrobacter phage CGermain, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH779506 Arthrobacter phage Guntur, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MF140426 Arthrobacter phage Seume, complete genome 12067-12094 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576948 Arthrobacter phage Azathoth, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160655 Arthrobacter phage Maggie, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KT355473 Arthrobacter phage Jessica, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MF140417 Arthrobacter phage Link, complete genome 12269-12296 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KY434670 Arthrobacter phage Chestnut, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MF140433 Arthrobacter phage TinoCrisci, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576957 Arthrobacter phage Inspire2, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576961 Arthrobacter phage Ronnie, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KX443695 Arthrobacter phage Courtney3, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160674 Arthrobacter phage Yank, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160657 Arthrobacter phage Moloch, complete genome 12346-12373 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KY224000 Mycobacterium phage Rich, complete genome 31645-31672 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160658 Arthrobacter phage Muttlie, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MK737943 Arthrobacter phage Arby, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KR080199 Mycobacterium phage Baee, complete genome 31675-31702 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH576952 Arthrobacter phage Dewayne, complete genome 12272-12299 7 0.75
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 KU160667 Arthrobacter phage Stratus, complete genome 12346-12373 7 0.75
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 19615-19642 7 0.75
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 114043-114070 7 0.75
NC_020133_6 6.5|2378589|28|NC_020133|CRT 2378589-2378616 28 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 588909-588936 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 887242-887269 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 445144-445171 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 454767-454794 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_LR134447 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence 221531-221558 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 453976-454003 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 430575-430602 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283144-283171 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1010972-1010999 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 149583-149610 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 541-568 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 115035-115062 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1195433-1195460 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 239867-239894 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 231586-231613 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 236175-236202 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NC_004963 Mycobacterium celatum plasmid pCLP, complete sequence 6084-6111 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 45584-45611 7 0.75
NC_020133_6 6.14|2379207|28|NC_020133|CRT 2379207-2379234 28 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 578201-578228 7 0.75
NC_020133_7 7.1|2660450|30|NC_020133|CRISPRCasFinder 2660450-2660479 30 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1088987-1089016 7 0.767
NC_020133_7 7.1|2660450|30|NC_020133|CRISPRCasFinder 2660450-2660479 30 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 434889-434918 7 0.767
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 23951-23982 7 0.781
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 69458-69489 7 0.781
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP024791 Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence 27005-27033 7 0.759
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP025052 Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence 10529-10557 7 0.759
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 697385-697413 7 0.759
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP015000 Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence 38196-38224 7 0.759
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 483594-483622 7 0.759
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NZ_CP049162 Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence 32773-32801 7 0.759
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 794534-794561 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1715416-1715443 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1633439-1633466 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 621443-621470 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 778826-778853 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 794614-794641 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1633463-1633490 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1393929-1393956 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1633437-1633464 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1539446-1539473 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1379495-1379522 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1482646-1482673 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 694691-694718 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 156658-156685 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MH809532 Burkholderia phage phiE131, complete genome 6846-6873 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MH809533 Burkholderia phage phiE058, complete genome 6846-6873 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 182773-182800 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 253254-253281 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 450305-450332 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 794382-794409 7 0.75
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 794360-794387 7 0.75
NC_020133_18 18.11|5897276|31|NC_020133|CRT 5897276-5897306 31 NZ_CP044332 Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence 193917-193947 7 0.774
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP007798 Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence 102693-102726 7 0.794
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 15596-15629 7 0.794
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 MH230879 Mycobacterium phage Xavia, complete genome 22628-22661 7 0.794
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 73196-73229 7 0.794
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 36120-36147 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 497744-497771 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 102072-102099 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 KY653127 Corynebacterium phage IME1320_01, complete genome 26839-26866 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 659609-659636 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 30565-30592 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4054327-4054354 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 391309-391336 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 19308-19335 7 0.75
NC_020133_19 19.4|6033322|28|NC_020133|CRT 6033322-6033349 28 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 215091-215118 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP019460 Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence 17405-17432 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1073352-1073379 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 11815-11842 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 675082-675109 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 332338-332365 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 473294-473321 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1659074-1659101 7 0.75
NC_020133_19 19.5|6033370|28|NC_020133|CRT 6033370-6033397 28 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 143118-143145 7 0.75
NC_020133_19 19.7|6033460|34|NC_020133|CRT 6033460-6033493 34 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 5352-5385 7 0.794
NC_020133_4 4.8|1145369|30|NC_020133|CRT 1145369-1145398 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 291469-291498 8 0.733
NC_020133_4 4.8|1145369|30|NC_020133|CRT 1145369-1145398 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 634853-634882 8 0.733
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 361868-361900 8 0.758
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 696174-696206 8 0.758
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_LR134453 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence 5564-5596 8 0.758
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 135352-135384 8 0.758
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 MH572335 Microviridae sp. isolate SD_SC_90, complete genome 825-852 8 0.714
NC_020133_6 6.4|2378526|28|NC_020133|CRT 2378526-2378553 28 NZ_CP034351 Streptomyces sp. W1SF4 plasmid p1, complete sequence 91195-91222 8 0.714
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 44441-44472 8 0.75
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 194653-194684 8 0.75
NC_020133_15 15.1|5186089|32|NC_020133|CRISPRCasFinder 5186089-5186120 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 45387-45418 8 0.75
NC_020133_15 15.3|5186221|29|NC_020133|CRISPRCasFinder 5186221-5186249 29 NC_006571 Streptomyces albulus plasmid pNO33 DNA, complete sequence 1636-1664 8 0.724
NC_020133_15 15.4|5186275|38|NC_020133|CRISPRCasFinder 5186275-5186312 38 NC_015065 Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence 175156-175193 8 0.789
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 383550-383577 8 0.714
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 630898-630925 8 0.714
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP048816 Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed 229980-230007 8 0.714
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 MN234176 Mycobacterium phage Yuna, complete genome 988-1015 8 0.714
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1258729-1258756 8 0.714
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 8727-8754 8 0.714
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1359505-1359541 8 0.784
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 961634-961670 8 0.784
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 89471-89507 8 0.784
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 618491-618527 8 0.784
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 185336-185369 8 0.765
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 274637-274670 8 0.765
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NC_008713 Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence 218146-218179 8 0.765
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 47534-47567 8 0.765
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_LR134468 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence 50631-50664 8 0.765
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 87274-87307 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 43764-43797 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 22575-22608 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010685 Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence 22518-22551 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 22568-22601 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 22386-22419 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 22483-22516 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 22541-22574 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 22569-22602 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 MH697577 Mycobacterium phage Amochick, complete genome 5675-5708 8 0.765
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 KT246485 Mycobacterium phage OBUpride, complete genome 5675-5708 8 0.765
NC_020133_3 3.7|907238|33|NC_020133|CRT 907238-907270 33 NZ_CP014688 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence 425018-425050 9 0.727
NC_020133_3 3.7|907238|33|NC_020133|CRT 907238-907270 33 MN657114 Psychrobacter sp. strain ANT_P52 plasmid pA52P6, complete sequence 16540-16572 9 0.727
NC_020133_3 3.9|907358|33|NC_020133|CRT 907358-907390 33 NC_012797 Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence 39139-39171 9 0.727
NC_020133_4 4.9|1145423|33|NC_020133|CRT 1145423-1145455 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1921408-1921440 9 0.727
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 284424-284457 9 0.735
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1971921-1971954 9 0.735
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 159224-159257 9 0.735
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 58017-58050 9 0.735
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 112755-112788 9 0.735
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 22438-22471 9 0.735
NC_020133_3 3.13|907580|36|NC_020133|CRT 907580-907615 36 NZ_CP022370 Bosea sp. AS-1 plasmid unnamed1, complete sequence 10043-10078 10 0.722
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 109942-109975 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1813883-1813916 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 1813885-1813918 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 661647-661680 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP020447 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence 115483-115516 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1140718-1140751 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1426733-1426766 10 0.706
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 646638-646671 10 0.706
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 MT114166 Microbacterium phage Nike, complete genome 5625-5658 10 0.706
NC_020133_19 19.9|6033559|34|NC_020133|CRT 6033559-6033592 34 NC_047975 Microbacterium phage Squash, complete genome 5680-5713 10 0.706
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 266483-266519 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 MK967395 Mycobacterium phage WideWale, complete genome 42859-42895 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 KX683875 Mycobacterium phage Baehexic, complete genome 42739-42775 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 KU297783 Mycobacterium phage NaSiaTalie, complete genome 42995-43031 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 MF919538 Mycobacterium phage Updawg, complete genome 42859-42895 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 MH825701 Mycobacterium phage Flare16, complete genome 42998-43034 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 MK061408 Mycobacterium phage Centaur, complete genome 42954-42990 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 KM197169 Mycobacterium phage Piro94, complete genome 42963-42999 11 0.703
NC_020133_18 18.8|5897105|37|NC_020133|CRT 5897105-5897141 37 KJ959632 Mycobacterium phage Equemioh13, complete genome 42859-42895 11 0.703
NC_020133_18 18.5|5896958|28|NC_020133|CRT 5896958-5896985 28 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 13563-13590 12 0.571
NC_020133_18 18.12|5897327|34|NC_020133|CRT 5897327-5897360 34 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 21211-21244 12 0.647

1. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 1, identity: 0.955 

gccggcgccatcaacgacggcg	CRISPR spacer
gccggcgccatcaacggcggcg	Protospacer
****************.*****

2. spacer 15.6|5186386|20|NC_020133|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.95 

cgacggcggagcgacgctga	CRISPR spacer
cgacggcggagcgacgctgg	Protospacer
*******************.

3. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

4. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

5. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

6. spacer 3.14|907637|24|NC_020133|CRT matches to MN304815 (Burkholderiales phage 68_11, complete genome) position: , mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgctgccgttgctgccgtt	Protospacer
**************** .******

7. spacer 3.14|907637|24|NC_020133|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 2, identity: 0.917 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtt	Protospacer
********.******* *******

8. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

9. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

10. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

11. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

12. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

13. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

14. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

15. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

16. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

17. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

18. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccggtgccgccggc	Protospacer
 *.*********************

19. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_LR723680 (Arsenite-oxidising bacterium NT-25 plasmid 4) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccgatgccgccgcc	Protospacer
*************.******** *

20. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_FO082821 (Rhizobium sp. NT-26 plasmid NT26_p1, complete sequence) position: , mismatch: 2, identity: 0.917 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccgatgccgccgcc	Protospacer
*************.******** *

21. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

22. spacer 13.3|3825144|22|NC_020133|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

23. spacer 13.3|3825144|22|NC_020133|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

24. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

25. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

26. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

27. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

28. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

29. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

30. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

31. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

32. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

33. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

34. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

35. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

36. spacer 13.3|3825144|22|NC_020133|CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
gccggcgccatcaaagacggct	Protospacer
************** ******

37. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP023158 (Xanthomonas citri pv. malvacearum strain AR81009 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcgccatcgacgacggcg	Protospacer
.***********.*********

38. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

39. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

40. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

41. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

42. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

43. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

44. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

45. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

46. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

47. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

48. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

49. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

50. spacer 13.3|3825144|22|NC_020133|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

51. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

52. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

53. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

54. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

55. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

56. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

57. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

58. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

59. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

60. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

61. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

62. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

63. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

64. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

65. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

66. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

67. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

68. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

69. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

70. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

71. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

72. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

73. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

74. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

75. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

76. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

77. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

78. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

79. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

80. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

81. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

82. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

83. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

84. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

85. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

86. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

87. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

88. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

89. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

90. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

91. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

92. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

93. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

94. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

95. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

96. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

97. spacer 13.3|3825144|22|NC_020133|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 2, identity: 0.909 

gccggcgccatcaacgacggcg	CRISPR spacer
accggcggcatcaacgacggcg	Protospacer
.****** **************

98. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 2, identity: 0.92 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aatgtcggcagcgcggggctggtcg	Protospacer
**** ********* **********

99. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.92 

caacgccgggctgttcggcaacggt	CRISPR spacer
caacgccggggtgttcggcaacggc	Protospacer
********** *************.

100. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.92 

caacgccgggctgttcggcaacggt	CRISPR spacer
ccacgccgggctgttcggcaacgga	Protospacer
* **********************

101. spacer 19.8|6033514|25|NC_020133|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.92 

aggcgccggcggggcgggcggactg	CRISPR spacer
cggcgccggcggggcgggcggaccg	Protospacer
 **********************.*

102. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.92 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacggctggcgccggcggtaat	Protospacer
******** ************.***

103. spacer 3.11|907478|24|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875 

accggtggcaccggtaccaccgtc	CRISPR spacer
gccggtggcaccggtgccaccggc	Protospacer
.**************.****** *

104. spacer 3.11|907478|24|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875 

accggtggcaccggtaccaccgtc	CRISPR spacer
gccggtggcaccggtgccaccggc	Protospacer
.**************.****** *

105. spacer 3.11|907478|24|NC_020133|CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 3, identity: 0.875 

accggtggcaccggtaccaccgtc	CRISPR spacer
gcctgtggcaccggtagcaccgtc	Protospacer
.** ************ *******

106. spacer 3.14|907637|24|NC_020133|CRT matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 3, identity: 0.875 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtc	Protospacer
********.******* ******.

107. spacer 3.14|907637|24|NC_020133|CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 3, identity: 0.875 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtc	Protospacer
********.******* ******.

108. spacer 3.14|907637|24|NC_020133|CRT matches to MH509447 (Microbacterium phage Eden, complete genome) position: , mismatch: 3, identity: 0.875 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgatgatgccgttgacgccgtc	Protospacer
**** ** ***************.

109. spacer 3.14|907637|24|NC_020133|CRT matches to KJ410133 (Mycobacterium phage Jolie2, complete genome) position: , mismatch: 3, identity: 0.875 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgccgccgttgccgccgtg	Protospacer
********.******* ******

110. spacer 3.14|907637|24|NC_020133|CRT matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 3, identity: 0.875 

gccgttgctgccgttgacgccgtt	CRISPR spacer
gccgttgctgccgtcgtcgccgtc	Protospacer
**************.* ******.

111. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 3, identity: 0.893 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgttgaagccgccggggccgctggt	Protospacer
********. **************** *

112. spacer 6.14|2379207|28|NC_020133|CRT matches to MN585977 (Mycobacterium phage Atcoo, complete genome) position: , mismatch: 3, identity: 0.893 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgccgccgcg	Protospacer
 *************.*********** *

113. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaatagctcaccggtgccgccggc	Protospacer
 *..********************

114. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaatagctcaccggtgccgccggc	Protospacer
 *..********************

115. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gggcagcacaccggtgccgccggc	Protospacer
 .***** ****************

116. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gggcagcacaccggtgccgccggc	Protospacer
 .***** ****************

117. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gggcagctcgccggtgccgccggc	Protospacer
 .*******.**************

118. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcgccggtgccgccggc	Protospacer
 *.******.**************

119. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggcggcgccggt	Protospacer
**************.* ******.

120. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
aaacagctcgccggtgccgccggc	Protospacer
 *.******.**************

121. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gagcagctcaccgctgcctccggc	Protospacer
 ************ **** *****

122. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
aaacagctcgccggtgccgccggc	Protospacer
 *.******.**************

123. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggcggcgccggt	Protospacer
**************.* ******.

124. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggcggcgccggt	Protospacer
**************.* ******.

125. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggcggcgccggt	Protospacer
**************.* ******.

126. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccagtgccgccggc	Protospacer
 *.*********.***********

127. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
aaacagctcgccggtgccgccggc	Protospacer
 *.******.**************

128. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctctccggtgccgcgggt	Protospacer
********* ********** **.

129. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcgccggtgccgccggc	Protospacer
 *.******.**************

130. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
gaacagctcaccagtgccgccggc	Protospacer
 *.*********.***********

131. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 3, identity: 0.875 

cagca-gctcaccggtgccgccggc	CRISPR spacer
-ggcgtgctcaccggtgccgccggc	Protospacer
 .**. *******************

132. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to KX641262 (Mycobacterium phage Nazo, complete genome) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggtgcctgcggg	Protospacer
******************  ***

133. spacer 9.3|2661056|24|NC_020133|CRISPRCasFinder matches to NC_023692 (Mycobacterium phage BigNuz, complete genome) position: , mismatch: 3, identity: 0.875 

cagcagctcaccggtgccgccggc	CRISPR spacer
cagcagctcaccggtgcctgcggg	Protospacer
******************  ***

134. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 3, identity: 0.88 

gacgcctggctgttcggcagcggcg	CRISPR spacer
cacgcccgcctgttcggcagcggcg	Protospacer
 *****.* ****************

135. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

gacgcctggctgttcggcagcggcg	CRISPR spacer
gacgccgggctggtcggcagcggtg	Protospacer
****** ***** **********.*

136. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

gacgcctggctgttcggcagcggcg	CRISPR spacer
ggcgccttggtgttcggcagcggcg	Protospacer
*.***** * ***************

137. spacer 13.6|3825294|25|NC_020133|CRT matches to KT630646 (Salmonella phage SEN5, complete genome) position: , mismatch: 3, identity: 0.88 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aaaggcgacagcgccgggctggttg	Protospacer
** ****.***************.*

138. spacer 13.6|3825294|25|NC_020133|CRT matches to KT630645 (Salmonella phage SEN4, complete genome) position: , mismatch: 3, identity: 0.88 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aaaggcgacagcgccgggctggttg	Protospacer
** ****.***************.*

139. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP022659 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence) position: , mismatch: 3, identity: 0.88 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aaaggcgacagcgccgggctggttg	Protospacer
** ****.***************.*

140. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP022659 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence) position: , mismatch: 3, identity: 0.88 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aaaggcgacagcgccgggctggttg	Protospacer
** ****.***************.*

141. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88 

aatggcggcagcgccgggctggtcg	CRISPR spacer
aatggcggcagagccggactggttg	Protospacer
*********** *****.*****.*

142. spacer 14.15|4245857|22|NC_020133|CRISPRCasFinder matches to NZ_CP049034 (Fluviibacterium aquatile strain SC52 plasmid pSC52_6, complete sequence) position: , mismatch: 3, identity: 0.864 

ggtgttgccaatatttccgaca	CRISPR spacer
cgtgttgccaatatttccgaac	Protospacer
 *******************

143. spacer 14.17|4246037|22|NC_020133|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.864 

gatgttgccgatattgccgctg	CRISPR spacer
gatgttgccgatattgccgacc	Protospacer
******************* .

144. spacer 14.17|4246037|22|NC_020133|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.864 

gatgttgccgatattgccgctg	CRISPR spacer
gatgttgccgatattgccgacc	Protospacer
******************* .

145. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP022419 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence) position: , mismatch: 3, identity: 0.897 

acccgccaagcccagcagcaaccaggccg--	CRISPR spacer
acccgcaaagcccagcagcaac--ggccgcc	Protospacer
****** ***************  *****

146. spacer 15.5|5186338|23|NC_020133|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.87 

taacggcgggtctgccgggctgt	CRISPR spacer
taacggcgggtctgccgagcttc	Protospacer
*****************.*** .

147. spacer 15.5|5186338|23|NC_020133|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.87 

taacggcgggtctgccgggctgt	CRISPR spacer
taacggcgggtctgccgagcttc	Protospacer
*****************.*** .

148. spacer 15.5|5186338|23|NC_020133|CRISPRCasFinder matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87 

taacggcgggtctgccgggctgt	CRISPR spacer
tgacggcgggtctgccgggcttc	Protospacer
*.******************* .

149. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.893 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
acccggcggcgacgccgggctgctgtcc	Protospacer
. ************************.*

150. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

caacgccgggctgttcggcaacggt	CRISPR spacer
caacgccgggctgatcggaaacggc	Protospacer
************* **** *****.

151. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

caacgccgggctgttcggcaacggt	CRISPR spacer
cgacgccgggctggtcggcagcggt	Protospacer
*.*********** ******.****

152. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 3, identity: 0.88 

aggcgccggcggggcgggcggactg	CRISPR spacer
gggcgccggcggcgcggccggactg	Protospacer
.*********** **** *******

153. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88 

aggcgccggcggggcgggcggactg	CRISPR spacer
tggggccggcggggccggcggactg	Protospacer
 ** *********** *********

154. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP033195 (Xanthomonas oryzae pv. oryzae strain CIAT plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggtggcgccggcggcagc	Protospacer
** ********************..

155. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP034654 (Xanthomonas vasicola pv. arecae strain NCPPB 2649 plasmid pXCARECAE29, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggtggcgccggcggcagc	Protospacer
** ********************..

156. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcgtcggcggcacc	Protospacer
**************.******** .

157. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP033202 (Xanthomonas oryzae pv. oryzae strain BXO1 plasmid pBXO1-1, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggtggcgccggcggcagc	Protospacer
** ********************..

158. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacggggggtgccggcggcaag	Protospacer
********* **.***********

159. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 3, identity: 0.88 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacaggtggcgccggcggcgac	Protospacer
******.***************.*.

160. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP010166 (Escherichia coli strain H2 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

161. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP048352 (Raoultella ornithinolytica strain 23 plasmid p23_C, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

162. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

163. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

164. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

165. spacer 3.14|907637|24|NC_020133|CRT matches to MG516909 (Escherichia coli plasmid pEc1675, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

166. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

167. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026058 (Citrobacter freundii strain FDAARGOS_73 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

168. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP022155 (Escherichia coli strain ABWA45 plasmid pABWA45_1, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

169. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026234 (Citrobacter freundii complex sp. CFNIH4 plasmid pCFR-4109, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

170. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP026272 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-f607, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

171. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP022152 (Citrobacter freundii strain 705SK3 plasmid p705SK3_1, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

172. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP041248 (Raoultella electrica strain DSM 102253 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

173. spacer 3.14|907637|24|NC_020133|CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

174. spacer 3.14|907637|24|NC_020133|CRT matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgttgctgccgttgacgccgtt	CRISPR spacer
cccattgctgccgttgacgccgca	Protospacer
 **.******************.

175. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acgtgccgttgccgccgtcgccgccgtc	Protospacer
   ********* ***************

176. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccgttgccgccatcgccgccagc	Protospacer
************ ***.********. *

177. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgccgccgttgccgccatcgccgccgtc	Protospacer
*.*.******** ***.***********

178. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgccgccgttgccgccatcgccgccgtc	Protospacer
*.*.******** ***.***********

179. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgctgcggttgcggccgtcaccgccggc	Protospacer
*.**** ************.****** *

180. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgc-cgttgcggccgtcgccgccgtc	CRISPR spacer
-acggcacgttgcggccgtcgccgtcgta	Protospacer
 ** ** *****************.***

181. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.857 

tactgcc-gttgcggccgtcgccgccgtc	CRISPR spacer
-gctaccggttgcggccttcgccgccgtc	Protospacer
 .**.** ********* ***********

182. spacer 6.4|2378526|28|NC_020133|CRT matches to KP087949 (Eel River basin pequenovirus isolate c15773, complete genome) position: , mismatch: 4, identity: 0.857 

tactg-ccgttgcggccgtcgccgccgtc	CRISPR spacer
-attgaccgtggcggccgtcgccgccgac	Protospacer
 *.** **** **************** *

183. spacer 6.5|2378589|28|NC_020133|CRT matches to MK524502 (Microbacterium phage TimoTea, complete genome) position: , mismatch: 4, identity: 0.857 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
agccggtggtgccgccggggccgttgtc	Protospacer
 **** *****************.***.

184. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 4, identity: 0.857 

-tgccgttggtgccgccggggccgctgtt	CRISPR spacer
gcgcc-ttggtgccgccggcgccgctgta	Protospacer
 .*** ************* ********

185. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgccgccgccggt	Protospacer
 **************** .********

186. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgccgccgccggt	Protospacer
 **************** .********

187. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgccgccgccggt	Protospacer
 **************** .********

188. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgccgccgccggt	Protospacer
 **************** .********

189. spacer 6.14|2379207|28|NC_020133|CRT matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tgccgccggtgccgccggtgccgccggt	Protospacer
 *************..***********

190. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gcccgccggtgccgtcgatgccgccgga	Protospacer
* *************.*.*********.

191. spacer 6.14|2379207|28|NC_020133|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.857 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgccggtgccgccgcg	Protospacer
 *************..********** *

192. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 4, identity: 0.857 

ggccg--ccggtgccgttggtgccgccggg	CRISPR spacer
--ccgaaccggtgccgattgtgccgccggg	Protospacer
  ***  ********* * ***********

193. spacer 7.3|2660543|24|NC_020133|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.833 

gccgccgttgctctccgcgcagtc	CRISPR spacer
tccgccgtcgctctccgcgcaggg	Protospacer
 *******.*************

194. spacer 13.2|3825099|25|NC_020133|CRT matches to KT347313 (Mycobacterium phage Brusacoram, complete genome) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggct	Protospacer
. *********** **********

195. spacer 13.2|3825099|25|NC_020133|CRT matches to MG198785 (Mycobacterium phage Thespis, complete genome) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggct	Protospacer
. *********** **********

196. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
agcgccgggatgttcggcagcggcg	Protospacer
..**** ** ***************

197. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
tccgccttgctgtacggcagcggcg	Protospacer
  ***** ***** ***********

198. spacer 13.2|3825099|25|NC_020133|CRT matches to MF158036 (Salmonella phage St161, complete genome) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
agcgccttgctgttcggcggcggcg	Protospacer
..***** **********.******

199. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
tattcctcgctgttcggcagcggcg	Protospacer
 *. *** *****************

200. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
caggcctggctgctcggcagcggct	Protospacer
 * *********.***********

201. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_013190 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph02, complete sequence) position: , mismatch: 4, identity: 0.84 

gacgcctggctgttcggcagcggcg	CRISPR spacer
ttcgcctggcttctcggcagcggcg	Protospacer
  ********* .************

202. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP021469 (Komagataeibacter europaeus strain SRCM101446 plasmid pKE1446-2, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
catggcggcagcgccgggctttccg	Protospacer
 *******************  .**

203. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP018236 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
ggtggcggcagctccgggcaggtcg	Protospacer
..********** ****** *****

204. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP004364 (Komagataeibacter xylinus E25 plasmid pGX4, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
catggcggcagcgccgggctttccg	Protospacer
 *******************  .**

205. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
catggcggcagcgccgtgctcgtca	Protospacer
 *************** *** ***.

206. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
cgtggcggcatcgccgggctgatcg	Protospacer
 .******** **********.***

207. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
gttggcggcaccgccgggctgctcg	Protospacer
. ******** ********** ***

208. spacer 13.6|3825294|25|NC_020133|CRT matches to NZ_CP019878 (Komagataeibacter nataicola strain RZS01 plasmid pKNA03, complete sequence) position: , mismatch: 4, identity: 0.84 

aatggcggcagcgccgggctggtcg	CRISPR spacer
catggcggcagcgccgggctttccg	Protospacer
 *******************  .**

209. spacer 14.10|4246151|27|NC_020133|CRT matches to NZ_CP022209 (Burkholderia gladioli pv. gladioli strain FDAARGOS_188 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852 

gttattcccgctgccgacgttgacgtc	CRISPR spacer
gttattccagctgccggcgttgacgat	Protospacer
******** *******.******** .

210. spacer 14.10|4246151|27|NC_020133|CRT matches to NZ_CP009321 (Burkholderia gladioli strain ATCC 10248 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852 

gttattcccgctgccgacgttgacgtc	CRISPR spacer
gttattccagctgccggcgttgacgat	Protospacer
******** *******.******** .

211. spacer 14.10|4246151|27|NC_020133|CRT matches to NZ_CP022007 (Burkholderia gladioli pv. gladioli strain KACC 11889 plasmid pls1, complete sequence) position: , mismatch: 4, identity: 0.852 

gttattcccgctgccgacgttgacgtc	CRISPR spacer
gttattccagctgccggcgttgacgat	Protospacer
******** *******.******** .

212. spacer 14.10|4246151|27|NC_020133|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 4, identity: 0.852 

gttattcccgctgccgacgttgacgtc	CRISPR spacer
ggtcttcccgcagcggacgttgacgtc	Protospacer
* * ******* ** ************

213. spacer 14.10|4246151|27|NC_020133|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 4, identity: 0.852 

gttattcccgctgccgacgttgacgtc	CRISPR spacer
ggtcttcccgcagcggacgttgacgtc	Protospacer
* * ******* ** ************

214. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ccccggcggcgaggccgagctgctgttc	Protospacer
  ********** ****.**********

215. spacer 18.5|5896958|28|NC_020133|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 4, identity: 0.857 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gggcggcggctacgccgggctgctgtgg	Protospacer
** ******* ***************

216. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 4, identity: 0.857 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggctacgccgggctggcggtc	Protospacer
********** *********** .* **

217. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
gcccgccgtgctgttcggcaacggt	Protospacer
   ***** ****************

218. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_DQ996271 (Burkholderia glumae BGR1 plasmid pBGF3, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
gaaggccgcgctgttcggcaacggc	Protospacer
 ** **** ***************.

219. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
caccgcctggctgttcggcaacgag	Protospacer
** **** ***************.

220. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
tgacgccggccttttcggcaacggt	Protospacer
..******* ** ************

221. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
caaggccgggctgttcggccacgtc	Protospacer
*** *************** *** .

222. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP009216 (Corynebacterium ureicelerivorans strain IMMIB RIV-2301 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
caacggcgggctgttcggcagcgtg	Protospacer
***** **************.**

223. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
cagcgccgggctgttcgccaacgcc	Protospacer
**.************** ***** .

224. spacer 18.9|5897162|25|NC_020133|CRT matches to NC_010879 (Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence) position: , mismatch: 4, identity: 0.84 

caacgccgggctgttcggcaacggt	CRISPR spacer
gaaggccgcgctgttcggcaacggc	Protospacer
 ** **** ***************.

225. spacer 18.13|5897381|25|NC_020133|CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 4, identity: 0.84 

caccggcctgagtaccggcagcacg	CRISPR spacer
ccccggcctgggtaccggcagcaaa	Protospacer
* ********.************ .

226. spacer 18.13|5897381|25|NC_020133|CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 4, identity: 0.84 

caccggcctgagtaccggcagcacg	CRISPR spacer
ccccggcctgggtaccggcagcaaa	Protospacer
* ********.************ .

227. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_015728 (Roseobacter litoralis Och 149 plasmid pRLO149_83, complete sequence) position: , mismatch: 4, identity: 0.857 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcggggcagggggcatt	Protospacer
* ****************.******* .

228. spacer 19.5|6033370|28|NC_020133|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

229. spacer 19.5|6033370|28|NC_020133|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

230. spacer 19.5|6033370|28|NC_020133|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

231. spacer 19.5|6033370|28|NC_020133|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

232. spacer 19.5|6033370|28|NC_020133|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

233. spacer 19.5|6033370|28|NC_020133|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

234. spacer 19.5|6033370|28|NC_020133|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

235. spacer 19.5|6033370|28|NC_020133|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

236. spacer 19.5|6033370|28|NC_020133|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

237. spacer 19.5|6033370|28|NC_020133|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

238. spacer 19.5|6033370|28|NC_020133|CRT matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

239. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 4, identity: 0.857 

cgggtc--cggcggcggggcggggggcaac	CRISPR spacer
--gctcgtcggcggcggggcgggcggcaac	Protospacer
  * **  *************** ******

240. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggcggggccggcggaggc	Protospacer
*************** ******

241. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
tggtgccggcggggcgggcggagtc	Protospacer
 **.****************** *

242. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

243. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

244. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP041652 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggtgccggcggggtgggcggacca	Protospacer
***.**********.********..

245. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

246. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

247. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggcgtggccggcggaccc	Protospacer
*********** *** *******.

248. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

249. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

250. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

251. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

252. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

253. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
gcgcgccggcggggcggacggaccg	Protospacer
. ***************.*****.*

254. spacer 19.8|6033514|25|NC_020133|CRT matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 4, identity: 0.84 

aggcgccggcggggcgggcggactg	CRISPR spacer
cggcgccgtcggggcgggcgtactt	Protospacer
 ******* *********** ***

255. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggctcgggtggcgccggcggcgcc	Protospacer
**** *****************. .

256. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcgcgggcggcggc	Protospacer
*************** ******...

257. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcactggcggcgccggcggcacg	Protospacer
****** **.*************

258. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcgcgggtggcgccggcggcttc	Protospacer
****.*****************  .

259. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcaccggcggaagc	Protospacer
*************.******* *..

260. spacer 19.11|6033676|25|NC_020133|CRT matches to CP030179 (Xanthomonas citri pv. punicae strain LMG 859 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

261. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

262. spacer 19.11|6033676|25|NC_020133|CRT matches to CP030170 (Xanthomonas citri pv. punicae strain BD0025 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

263. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggtacgggcggcgccggcggcaca	Protospacer
***.*****.*************

264. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgccggcagcagc	Protospacer
****** ************.***..

265. spacer 19.11|6033676|25|NC_020133|CRT matches to CP030162 (Xanthomonas citri pv. punicae strain BD0023 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

266. spacer 19.11|6033676|25|NC_020133|CRT matches to CP030160 (Xanthomonas citri pv. punicae strain BD0022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

267. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gggcaccggaggcgccggcggcaaa	Protospacer
 ***** ** **************

268. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

269. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgccggcagcagc	Protospacer
****** ************.***..

270. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgccggcagcagc	Protospacer
****** ************.***..

271. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

272. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP030165 (Xanthomonas citri pv. punicae strain LMG7439 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

273. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP020696 (Sulfitobacter sp. D7 plasmid p2SUD7, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
tggcacgggtggtgccggcagcaac	Protospacer
.***********.******.****.

274. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP049320 (Caballeronia sp. SBC2 plasmid pSBC2-4, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggtacgggcggcgccggcggcaca	Protospacer
***.*****.*************

275. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

276. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgccggcagcagc	Protospacer
****** ************.***..

277. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcaccgccggcacc	Protospacer
*************.*** ***** .

278. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

279. spacer 19.11|6033676|25|NC_020133|CRT matches to CP030167 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

280. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

281. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

282. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

283. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gagcaagggtggcgccggcggtaat	Protospacer
 .*** ***************.***

284. spacer 19.11|6033676|25|NC_020133|CRT matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cgccacgggcggcgccggcggcagc	Protospacer
** ******.*************..

285. spacer 19.11|6033676|25|NC_020133|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggcgtcgccggcggcatg	Protospacer
*********.* ***********

286. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggcggggccggcggcagc	Protospacer
*********.** **********..

287. spacer 19.11|6033676|25|NC_020133|CRT matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gggcaccggaggcgccggcggcaaa	Protospacer
 ***** ** **************

288. spacer 19.11|6033676|25|NC_020133|CRT matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gggcaccggaggcgccggcggcaaa	Protospacer
 ***** ** **************

289. spacer 19.11|6033676|25|NC_020133|CRT matches to MN694606 (Marine virus AFVG_250M830, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
gggcacggctggcgctggcggcaag	Protospacer
 ******* ******.********

290. spacer 19.11|6033676|25|NC_020133|CRT matches to AP018462 (Mycobacterium phage D12 DNA, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgcaggcggcacc	Protospacer
****** ******** ******* .

291. spacer 19.11|6033676|25|NC_020133|CRT matches to AP018463 (Mycobacterium phage PR DNA, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgcaggcggcacc	Protospacer
****** ******** ******* .

292. spacer 19.11|6033676|25|NC_020133|CRT matches to AY616033 (Burkholderia cenocepacia phage BcepB1A, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggcggcggcggcggcacg	Protospacer
*********.**** ********

293. spacer 19.11|6033676|25|NC_020133|CRT matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 4, identity: 0.84 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcaccggtggcgcaggcggcacc	Protospacer
****** ******** ******* .

294. spacer 4.15|1145837|27|NC_020133|CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 5, identity: 0.815 

cccccgccgctgccctgcgggctggag	CRISPR spacer
cgcccgccgctgcccttcgggcagggc	Protospacer
* ************** ***** **.

295. spacer 4.15|1145837|27|NC_020133|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815 

cccccgccgctgccctgcgggctggag	CRISPR spacer
cttgcggcgctgcccttcgggctggag	Protospacer
*.. ** ********* **********

296. spacer 4.15|1145837|27|NC_020133|CRT matches to NZ_CP019241 (Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1) position: , mismatch: 5, identity: 0.815 

cccccgccgctgccctgcgggctggag	CRISPR spacer
accccggcgctgcactgcgggctgctg	Protospacer
 ***** ****** **********  *

297. spacer 4.15|1145837|27|NC_020133|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 5, identity: 0.815 

cccccgccgctgccctgcgggctggag	CRISPR spacer
ggcacgccgccgccctgcgggccggag	Protospacer
  * ******.***********.****

298. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgccgccgttgccgccgttgccgccgtt	Protospacer
*.*.******** *****.********.

299. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgccgccgttgccgccgttgccgccgtt	Protospacer
*.*.******** *****.********.

300. spacer 6.4|2378526|28|NC_020133|CRT matches to AJ304453 (Uncultured bacterium plasmid pSB102 complete genome) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gcctgccgttgcgcccgtcgtcgccgtg	Protospacer
  *********** ******.******

301. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgccggc	Protospacer
..** ************* ******* *

302. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgccggc	Protospacer
..** ************* ******* *

303. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcggccgttgcggccttcgacgccgtc	Protospacer
..* ************ *** *******

304. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tcccgccgttgcggccatcgccgccgag	Protospacer
* *.************.*********

305. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP047184 (Rathayibacter sp. VKM Ac-2801 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggctgccgatgcggccttcgccgccggc	Protospacer
 .****** ******* ********* *

306. spacer 6.4|2378526|28|NC_020133|CRT matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gaaggccgttgctgccgtcgtcgccgtc	Protospacer
 *  ******** *******.*******

307. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgccggc	Protospacer
..** ************* ******* *

308. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP047181 (Rathayibacter festucae strain VKM Ac-2802 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggctgccgatgcggccttcgccgccggc	Protospacer
 .****** ******* ********* *

309. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tcgggccggtgcggccgtcgtcgccgtc	Protospacer
*   **** ***********.*******

310. spacer 6.4|2378526|28|NC_020133|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
agccgccgttgccgccgtcgcccccgtc	Protospacer
 .*.******** ********* *****

311. spacer 6.4|2378526|28|NC_020133|CRT matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tcacgccgttgccgccgttgccgccgtc	Protospacer
*  .******** *****.*********

312. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_026598 (Mycobacterium phage Milly, complete genome) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acctgccgttgtggccgtcgccgcgggc	Protospacer
  *********.************ * *

313. spacer 6.4|2378526|28|NC_020133|CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tcacgccgttgccgccgttgccgccgtc	Protospacer
*  .******** *****.*********

314. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.821 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tgctgccgttgccgccgccgccgccaac	Protospacer
*.********** ****.*******. *

315. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttggggccgcgggggccgctgca	Protospacer
.******** ***** **********.

316. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttggggccgcgggggccgctgca	Protospacer
.******** ***** **********.

317. spacer 6.5|2378589|28|NC_020133|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttggggccgcgggggccgctgca	Protospacer
.******** ***** **********.

318. spacer 6.5|2378589|28|NC_020133|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttggggccgcgggggccgctgca	Protospacer
.******** ***** **********.

319. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgatggtgccgccggcgccgccgcg	Protospacer
***** ************ *****.*.

320. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgatggtgccgccggcgccgccgcg	Protospacer
***** ************ *****.*.

321. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgatggtgccgccggcgccgccgcg	Protospacer
***** ************ *****.*.

322. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
gcccgttggtggcgccggggccgatggt	Protospacer
  ********* *********** ** *

323. spacer 6.5|2378589|28|NC_020133|CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgatggtgccgccggcgccgccgcg	Protospacer
***** ************ *****.*.

324. spacer 6.5|2378589|28|NC_020133|CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgatggtgccgccggcgccgccgcg	Protospacer
***** ************ *****.*.

325. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

326. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
ggccgatggagccgccggggccgccggt	Protospacer
 **** *** **************.* *

327. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

328. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccggggccgtcgtg	Protospacer
*****..****************..**

329. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgttggtgccgctcgggccgacggt	Protospacer
***************. ****** .* *

330. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgtcggtgccgccggtgccgcgctt	Protospacer
.*****.*********** *****  **

331. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

332. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

333. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

334. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
ggccgatggagccgccggggccgccggt	Protospacer
 **** *** **************.* *

335. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgttggtgccgctcgggccgacggt	Protospacer
***************. ****** .* *

336. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgccggtgccgccggggccgtcgtg	Protospacer
*****..****************..**

337. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

338. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

339. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

340. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

341. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcgttggtggcgccggggccgcgggt	Protospacer
.* ******** ************ * *

342. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgttgccgacgca	Protospacer
 **************** ***** ** .

343. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgttgccgacgca	Protospacer
 **************** ***** ** .

344. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cccggccggtgcccttggtgccgccggt	Protospacer
  * ********* *************

345. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cccggccggtgcccttggtgccgccggt	Protospacer
  * ********* *************

346. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgccggtgccgtgggagccgccggc	Protospacer
 .************* ** ********

347. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tgatgccggtgccgctggtgccgccggt	Protospacer
 * .**********.************

348. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP013299 (Arthrobacter sp. YC-RL1 plasmid unnamed 2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggcagccggtgccggtggtgccgcgttg	Protospacer
*** ********** *********   *

349. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

350. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

351. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

352. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgccggtgccctgggtgccgccggt	Protospacer
 * ********** * ***********

353. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgccggtgccctgggtgccgccggt	Protospacer
 * ********** * ***********

354. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP014508 (Burkholderia sp. PAMC 28687 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
agcatgcggtgccgttgatgccgccggg	Protospacer
.**   ***********.**********

355. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

356. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

357. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

358. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

359. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP038032 (Rhodococcus ruber strain R1 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgctggtgcctttggtgccgcggcc	Protospacer
******.****** ********** *

360. spacer 6.14|2379207|28|NC_020133|CRT matches to MT024866 (Mycobacterium phage Willsammy, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

361. spacer 6.14|2379207|28|NC_020133|CRT matches to MN892486 (Mycobacterium phage KilKor, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

362. spacer 6.14|2379207|28|NC_020133|CRT matches to MN945904 (Mycobacterium phage Eponine, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctgctgccgccaga	Protospacer
 *************.** *******.*.

363. spacer 6.14|2379207|28|NC_020133|CRT matches to MN908683 (Mycobacterium phage StressBall, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

364. spacer 6.14|2379207|28|NC_020133|CRT matches to MN892484 (Mycobacterium phage CactusJack, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

365. spacer 6.14|2379207|28|NC_020133|CRT matches to MT498061 (Mycobacterium phage Jung, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

366. spacer 6.14|2379207|28|NC_020133|CRT matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

367. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

368. spacer 6.14|2379207|28|NC_020133|CRT matches to MN807250 (Mycobacterium phage Glaske, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

369. spacer 6.14|2379207|28|NC_020133|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
agccgccggtgccgctgctgccgccaga	Protospacer
.*************.** *******.*.

370. spacer 6.14|2379207|28|NC_020133|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
agccgccggtgccgctgctgccgccaga	Protospacer
.*************.** *******.*.

371. spacer 6.14|2379207|28|NC_020133|CRT matches to MN807248 (Mycobacterium phage Phalm, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgcggcctcg	Protospacer
 *************.****** ***  *

372. spacer 6.14|2379207|28|NC_020133|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

373. spacer 6.14|2379207|28|NC_020133|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccggtggcgccgcccgc	Protospacer
 ************* ***.****** *

374. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ctccgccggtggcgctggtgccgccgcg	Protospacer
  ********* **.*********** *

375. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgacgccggtgccgtcggtaccgccgcg	Protospacer
 * ************.***.****** *

376. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgacgccggtgccgtcggtaccgccgcg	Protospacer
 * ************.***.****** *

377. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gggcgccggtgccggtggtgccggagag	Protospacer
** *********** ********  *.*

378. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_049823 (Escherichia phage herni, complete genome) position: , mismatch: 5, identity: 0.821 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccgctgccgttgttgccgcagtg	Protospacer
 ******* ******** ****** * *

379. spacer 13.2|3825099|25|NC_020133|CRT matches to MF919525 (Mycobacterium phage Murica, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

380. spacer 13.2|3825099|25|NC_020133|CRT matches to MF668281 (Mycobacterium phage RitaG, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

381. spacer 13.2|3825099|25|NC_020133|CRT matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

382. spacer 13.2|3825099|25|NC_020133|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

383. spacer 13.2|3825099|25|NC_020133|CRT matches to MH669010 (Mycobacterium phage PHappiness, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

384. spacer 13.2|3825099|25|NC_020133|CRT matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

385. spacer 13.2|3825099|25|NC_020133|CRT matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

386. spacer 13.2|3825099|25|NC_020133|CRT matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

387. spacer 13.2|3825099|25|NC_020133|CRT matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

388. spacer 13.2|3825099|25|NC_020133|CRT matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

389. spacer 13.2|3825099|25|NC_020133|CRT matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggat	Protospacer
. *********** *********

390. spacer 13.2|3825099|25|NC_020133|CRT matches to MN096364 (Mycobacterium phage Tomaszewski, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

391. spacer 13.2|3825099|25|NC_020133|CRT matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

392. spacer 13.2|3825099|25|NC_020133|CRT matches to MF190168 (Mycobacterium phage Spoonbill, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

393. spacer 13.2|3825099|25|NC_020133|CRT matches to JF937090 (Mycobacterium virus BAKA, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggat	Protospacer
. *********** *********

394. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

395. spacer 13.2|3825099|25|NC_020133|CRT matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

396. spacer 13.2|3825099|25|NC_020133|CRT matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

397. spacer 13.2|3825099|25|NC_020133|CRT matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

398. spacer 13.2|3825099|25|NC_020133|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

399. spacer 13.2|3825099|25|NC_020133|CRT matches to JF937106 (Mycobacterium phage SirDuracell, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

400. spacer 13.2|3825099|25|NC_020133|CRT matches to KC748969 (Mycobacterium phage Phaux, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

401. spacer 13.2|3825099|25|NC_020133|CRT matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

402. spacer 13.2|3825099|25|NC_020133|CRT matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

403. spacer 13.2|3825099|25|NC_020133|CRT matches to MH590596 (Mycobacterium phage Mantra, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

404. spacer 13.2|3825099|25|NC_020133|CRT matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

405. spacer 13.2|3825099|25|NC_020133|CRT matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

406. spacer 13.2|3825099|25|NC_020133|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

407. spacer 13.2|3825099|25|NC_020133|CRT matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

408. spacer 13.2|3825099|25|NC_020133|CRT matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

409. spacer 13.2|3825099|25|NC_020133|CRT matches to MH632119 (Mycobacterium phage Harley, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

410. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

411. spacer 13.2|3825099|25|NC_020133|CRT matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

412. spacer 13.2|3825099|25|NC_020133|CRT matches to MK279849 (Mycobacterium phage Duke13, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggat	Protospacer
. *********** *********

413. spacer 13.2|3825099|25|NC_020133|CRT matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

414. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

415. spacer 13.2|3825099|25|NC_020133|CRT matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

416. spacer 13.2|3825099|25|NC_020133|CRT matches to KF562100 (Mycobacterium phage HufflyPuff, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

417. spacer 13.2|3825099|25|NC_020133|CRT matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggat	Protospacer
. *********** *********

418. spacer 13.2|3825099|25|NC_020133|CRT matches to HQ728524 (Mycobacterium phage Wee, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

419. spacer 13.2|3825099|25|NC_020133|CRT matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

420. spacer 13.2|3825099|25|NC_020133|CRT matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

421. spacer 13.2|3825099|25|NC_020133|CRT matches to MH669005 (Mycobacterium phage JoeyJr, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

422. spacer 13.2|3825099|25|NC_020133|CRT matches to MN586044 (Mycobacterium phage Rimmer, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggtt	Protospacer
. *********** *********.

423. spacer 13.2|3825099|25|NC_020133|CRT matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

424. spacer 13.2|3825099|25|NC_020133|CRT matches to KT020852 (Mycobacterium phage NoSleep, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

425. spacer 13.2|3825099|25|NC_020133|CRT matches to MK875792 (Mycobacterium phage Polka14, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

426. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

427. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_021305 (Mycobacterium phage Murphy, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

428. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_022068 (Mycobacteriophage Daenerys, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcggaa	Protospacer
. *********** ********* .

429. spacer 13.2|3825099|25|NC_020133|CRT matches to JF937093 (Mycobacterium virus DLane, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

430. spacer 13.2|3825099|25|NC_020133|CRT matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

431. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_025433 (Mycobacteriophage Taj, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

432. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

433. spacer 13.2|3825099|25|NC_020133|CRT matches to MK494116 (Mycobacterium phage Dulcie, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

434. spacer 13.2|3825099|25|NC_020133|CRT matches to MH001458 (Mycobacterium phage Smeagol, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

435. spacer 13.2|3825099|25|NC_020133|CRT matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 5, identity: 0.8 

gacgcctggctgttcggcagcggcg	CRISPR spacer
atcgcctggctgtacggcagcgggt	Protospacer
. *********** *********

436. spacer 13.6|3825294|25|NC_020133|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.8 

aatggcggcagcgccgggctggtcg	CRISPR spacer
ggcggcggcagcgacgggctggtcc	Protospacer
...********** **********

437. spacer 13.6|3825294|25|NC_020133|CRT matches to MK059749 (Mycobacterium phage CRB2, complete genome) position: , mismatch: 5, identity: 0.8 

aatggcggcagcgccgggctggtcg	CRISPR spacer
cggcgcggcagcgccgggctggttg	Protospacer
 .  *******************.*

438. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

439. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

440. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

441. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

442. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

443. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

444. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgacgccgtgccgctggga	Protospacer
***************** **.****

445. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

446. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

447. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctactggaa	Protospacer
*********.***********.***

448. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP043045 (Gluconobacter thailandicus strain HD924 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tgcctgcggcgacgccgagctgctggcc	Protospacer
 *** ************.******* .*

449. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgacgccggacggcttatg	Protospacer
******************.* ***  *

450. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgacgccgaactgcacgtc	Protospacer
*****************..****   **

451. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgatgccgggcagcagccc	Protospacer
************.******* ** *..*

452. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggagcgcgccgacgccgggctgctgctc	Protospacer
**   *** ****************.**

453. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgactccgggctcaccttc	Protospacer
************* *******  . ***

454. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_024957 (Methylibium sp. T29 plasmid pT29A, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
aggcggcggcgctgccgggctgctgtgc	Protospacer
.* ******** .************* *

455. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_024958 (Methylibium sp. T29-B plasmid pT29B, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
aggcggcggcgctgccgggctgctgtgc	Protospacer
.* ******** .************* *

456. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
agcgggcggcgacgccgagctgctcctc	Protospacer
.** *************.****** .**

457. spacer 18.5|5896958|28|NC_020133|CRT matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggct-gctgttc	CRISPR spacer
ggccggccgcgacgccgggctcggtgac-	Protospacer
******* ************* * ** .

458. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_018580 (Gordonia sp. KTR9 plasmid pGKT2, complete sequence) position: , mismatch: 5, identity: 0.821 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cggcggcggccacgccgggctggtgtcc	Protospacer
 * ******* *********** ***.*

459. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.8 

caacgccgggctgttcggcaacggt	CRISPR spacer
tcacgccgcgctgttcggcaacgcg	Protospacer
. ****** **************

460. spacer 18.9|5897162|25|NC_020133|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 5, identity: 0.8 

caacgccgggctgttcggcaacggt	CRISPR spacer
tggcgccgtgctgttcggcaacggc	Protospacer
...***** ***************.

461. spacer 18.9|5897162|25|NC_020133|CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 5, identity: 0.8 

caacgccgggctgttcggcaacggt	CRISPR spacer
tggcgccgtgctgttcggcaacggc	Protospacer
...***** ***************.

462. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gttgagcggccgcttttccggcggcaac	Protospacer
  .** **** *****************

463. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cacgatcgccggctttttcggcggcatc	Protospacer
..****** ********.******** *

464. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cacgatcgccggctttttcggcggcatc	Protospacer
..****** ********.******** *

465. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cacgatcgccggctttttcggcggcatc	Protospacer
..****** ********.******** *

466. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
tgcgatcggcggcgttgccggcggtatg	Protospacer
************* ** *******.*

467. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cacgatcgccggctttttcggcggcatc	Protospacer
..****** ********.******** *

468. spacer 19.4|6033322|28|NC_020133|CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
agccacgggcggctgttccggcggcaac	Protospacer
 ** *. ******* *************

469. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcg-atcggcggcttttccggcggcaac	CRISPR spacer
-gcacttcggcggctttggcggcggcaac	Protospacer
 **.  ***********  **********

470. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821 

tgcg-atcggcggcttttccggcggcaac	CRISPR spacer
-gcacttcggcggctttggcggcggcaac	Protospacer
 **.  ***********  **********

471. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP049042 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_5, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcggggcagggggcttg	Protospacer
* ****************.******

472. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tctgaccggcggcggggcggcgggcaac	Protospacer
.  * *************** *******

473. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tctgaccggcggcggggcggcgggcaac	Protospacer
.  * *************** *******

474. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgggtccggcggccgagcggggggcgcg	Protospacer
************* *.*********.

475. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP045391 (Roseivivax sp. THAF30 plasmid pTHAF30_b, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcggggcagggggcttg	Protospacer
* ****************.******

476. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP045363 (Roseivivax sp. THAF40 plasmid pTHAF40_c, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcggggcagggggcttg	Protospacer
* ****************.******

477. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP045388 (Ruegeria sp. THAF33 plasmid pTHAF33_d, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcggggcagggggcttg	Protospacer
* ****************.******

478. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
aagatccggcggcggggcgggcggccac	Protospacer
 .*.***************** *** **

479. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ctgctccggcggcggggcagggggcacg	Protospacer
* * **************.*******

480. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac-	CRISPR spacer
cgggtccagcggcggggc-ggcggcggcg	Protospacer
*******.********** ** ***..*

481. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac-	CRISPR spacer
cgggtccagcggcggcgc-gggggcggcg	Protospacer
*******.******* ** ******..*

482. spacer 19.5|6033370|28|NC_020133|CRT matches to DI373491 (KR 1020130142837-A/5: Bacteriophage of Pseudomonas aeruginosa and uses thereof) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

483. spacer 19.5|6033370|28|NC_020133|CRT matches to JX131330 (Pseudomonas phage MP1412, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

484. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_010116 (Pseudomonas phage YuA, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

485. spacer 19.5|6033370|28|NC_020133|CRT matches to MH791406 (UNVERIFIED: Pseudomonas phage PaSz-4, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

486. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_028980 (Pseudomonas phage PAE1, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

487. spacer 19.5|6033370|28|NC_020133|CRT matches to MF490239 (Pseudomonas phage vB_PaeS_S218, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

488. spacer 19.5|6033370|28|NC_020133|CRT matches to DQ163916 (Bacteriophage M6, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

489. spacer 19.5|6033370|28|NC_020133|CRT matches to KX198613 (Pseudomonas phage AN14, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

490. spacer 19.5|6033370|28|NC_020133|CRT matches to KC758116 (Pseudomonas phage LKO4, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

491. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_007809 (Pseudomonas phage M6, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

492. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggg--gggcaac	CRISPR spacer
cgcgtccggcggcggggcgggctgggtg--	Protospacer
** ******************  ***..

493. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871482 (UNVERIFIED: Pseudomonas virus PaSz-6, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

494. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871486 (UNVERIFIED: Pseudomonas phage PaSz-9_45_61k, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

495. spacer 19.5|6033370|28|NC_020133|CRT matches to MH791403 (UNVERIFIED: Pseudomonas phage PaTs-2, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

496. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871463 (UNVERIFIED: Pseudomonas phage Pa-L, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

497. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871456 (UNVERIFIED: Pseudomonas phage Pa-C, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

498. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871469 (UNVERIFIED: Pseudomonas phage Pa-S, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

499. spacer 19.5|6033370|28|NC_020133|CRT matches to MN871478 (UNVERIFIED: Pseudomonas phage PaSt-2_45_61k, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

500. spacer 19.5|6033370|28|NC_020133|CRT matches to MT118302 (Pseudomonas phage Epa38, complete genome) position: , mismatch: 5, identity: 0.821 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgactccggcggcggggcggcgggcgtc	Protospacer
**. **************** ****. *

501. spacer 19.8|6033514|25|NC_020133|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 5, identity: 0.8 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggccgggcgggcgggggt	Protospacer
********** **********.

502. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 5, identity: 0.8 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggccgggcgggcgggggt	Protospacer
********** **********.

503. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 5, identity: 0.8 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggccgggcgggcgggggt	Protospacer
********** **********.

504. spacer 19.8|6033514|25|NC_020133|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 5, identity: 0.8 

aggcgccggcggggcgggcggactg	CRISPR spacer
aggcgccggccgggcgggcgggggt	Protospacer
********** **********.

505. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcggcggcggatgg	Protospacer
************** ******  .

506. spacer 19.11|6033676|25|NC_020133|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 5, identity: 0.8 

cggcacgggtggcgccggcggcaat	CRISPR spacer
cggcacgggtggcgcgggcggagca	Protospacer
*************** ***** .

507. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818 

---ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
acctcgcc---gctgccgcccccgctgccgccgccg	Protospacer
   *.***   *****.**************** **

508. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gttggccgctgcggccgtcgccgccggc	Protospacer
  . ****.***************** *

509. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
atccgccgttgccgccgtcgcctccgtt	Protospacer
  *.******** ********* ****.

510. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcggccgtcgcggccgtcgccgccgct	Protospacer
..* *****.****************..

511. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

512. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggccgccgtcgcggccgtcgccgccgag	Protospacer
 .*.*****.****************

513. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_023282 (Streptomyces sp. FR1 plasmid pFRL2, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cggagccgtcgcggtcgtcgccgccgtc	Protospacer
..  *****.****.*************

514. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022578 (Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
agcttccgttgcggccgtggccgccgcg	Protospacer
 .** ************* *******.

515. spacer 6.4|2378526|28|NC_020133|CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccttgccgtcgcggccgtcggcgccgtt	Protospacer
. .******.********** ******.

516. spacer 6.4|2378526|28|NC_020133|CRT matches to KT221033 (Streptomyces phage SF1, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccttgccgtcgcggccgtcggcgccgtt	Protospacer
. .******.********** ******.

517. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cggtgaagttgcggcagtcgccgccgtc	Protospacer
.. **  ******** ************

518. spacer 6.4|2378526|28|NC_020133|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

519. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

520. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

521. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cccggccgttccgcccgtcgccgccgtt	Protospacer
. * ****** ** *************.

522. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP016879 (Xanthomonas hortorum strain B07-007 plasmid pB07007, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgcctgc	Protospacer
..** ************* ******  *

523. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

524. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

525. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

526. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

527. spacer 6.4|2378526|28|NC_020133|CRT matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgcctgc	Protospacer
..** ************* ******  *

528. spacer 6.4|2378526|28|NC_020133|CRT matches to CP022269 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plB, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgcctgc	Protospacer
..** ************* ******  *

529. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
agttgccgttgccgccgttgccgccgac	Protospacer
 ..********* *****.******* *

530. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

531. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

532. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

533. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

534. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

535. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

536. spacer 6.4|2378526|28|NC_020133|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

537. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

538. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

539. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

540. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

541. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

542. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

543. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

544. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

545. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

546. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

547. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

548. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

549. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

550. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

551. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

552. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

553. spacer 6.4|2378526|28|NC_020133|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

554. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

555. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

556. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

557. spacer 6.4|2378526|28|NC_020133|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgccgccgttgccgccgttgccgccgtt	Protospacer
..*.******** *****.********.

558. spacer 6.4|2378526|28|NC_020133|CRT matches to KC787101 (Mycobacterium phage 33D, partial genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

559. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

560. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

561. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

562. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

563. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gatgaccgtgtcggccgtcgccgccgtc	Protospacer
 *. .****  *****************

564. spacer 6.4|2378526|28|NC_020133|CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
aactgccgtatcggccgtcgccgctgga	Protospacer
 ********  *************.*

565. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

566. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

567. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

568. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

569. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gccccccgttcccgccgtcgccgccgtc	Protospacer
  *. ***** * ***************

570. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

571. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

572. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

573. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

574. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

575. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

576. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

577. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

578. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

579. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

580. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

581. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

582. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

583. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

584. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

585. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

586. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

587. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

588. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

589. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctataccgaggcggccgtcgccgccgtc	Protospacer
.  *.***  ******************

590. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP018733 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.2, complete sequence) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgcttccgttgcggccgtagccgcctgc	Protospacer
..** ************* ******  *

591. spacer 6.4|2378526|28|NC_020133|CRT matches to MH727545 (Mycobacterium phage DismalStressor, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

592. spacer 6.4|2378526|28|NC_020133|CRT matches to AF068845 (Mycobacteriophage TM4, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

593. spacer 6.4|2378526|28|NC_020133|CRT matches to KX688047 (Mycobacterium phage Marcoliusprime, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

594. spacer 6.4|2378526|28|NC_020133|CRT matches to MF140408 (Mycobacterium phage DismalFunk, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

595. spacer 6.4|2378526|28|NC_020133|CRT matches to KJ410133 (Mycobacterium phage Jolie2, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gagcgccgttgccgccgttgccgccgtg	Protospacer
 * .******** *****.********

596. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_003387 (Mycobacterium phage TM4, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acttgccgttgtggccgtcgccgcgggc	Protospacer
  .********.************ * *

597. spacer 6.4|2378526|28|NC_020133|CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 6, identity: 0.786 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggctgccgttgccgccgccgccgcccgc	Protospacer
 .********** ****.*******  *

598. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccggtggtgccgccggggccgccccc	Protospacer
.**** ******************. ..

599. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttggggctgccggggccgcggcg	Protospacer
.******** **.*********** *.

600. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tcccgctggtgccgccgggcccgctacc	Protospacer
* ***.************* *****...

601. spacer 6.5|2378589|28|NC_020133|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
ggaagttggtgccgccgcggccgccgta	Protospacer
 *  ************* ******.**

602. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
ggccgctggggccgccggggccgccgcc	Protospacer
 ****.*** **************.*..

603. spacer 6.5|2378589|28|NC_020133|CRT matches to MN694768 (Marine virus AFVG_250M955, complete genome) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cggcggtggtgccgccggggccgccggc	Protospacer
.* ** ******************.* .

604. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgttgatgccgccgcggccgacgga	Protospacer
********.******** ***** .*

605. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgaagctggtgccgccggggccgttgta	Protospacer
.*  *.*****************.***

606. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
agccggtggtgccgccggtgccgccgcc	Protospacer
 **** ************ *****.*..

607. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
gcgcattggtggcgccggggccgctggt	Protospacer
   *.****** ************** *

608. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
tgccgttgctgctgccggggccggcact	Protospacer
******** ***.********** ...*

609. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcggcggtgccgttggcgccgccgct	Protospacer
 *.** ************.*******

610. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcggcggtgccgttggcgccgccgct	Protospacer
 *.** ************.*******

611. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgctggtgccgctatt	Protospacer
 *************.*********..

612. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ctgcgccggtgccgctggtgccgcaggc	Protospacer
   ***********.********* **

613. spacer 6.14|2379207|28|NC_020133|CRT matches to MF919496 (Mycobacterium phage Cerulean, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

614. spacer 6.14|2379207|28|NC_020133|CRT matches to HM152766 (Mycobacterium phage Eagle, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

615. spacer 6.14|2379207|28|NC_020133|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

616. spacer 6.14|2379207|28|NC_020133|CRT matches to JN699015 (Mycobacterium virus LHTSCC, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

617. spacer 6.14|2379207|28|NC_020133|CRT matches to MH651170 (Mycobacterium phage ChampagnePapi, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

618. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_023577 (Mycobacterium phage Obama12, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

619. spacer 6.14|2379207|28|NC_020133|CRT matches to MK878895 (Mycobacterium phage SheldonCooper, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgcccgtgccgttcgtgccgccgca	Protospacer
 .***** ******** ********* .

620. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ccgcgccgatgccggtggtgccgccggt	Protospacer
   *****.***** ************

621. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caccgccggtgccgccggtgccgccgcc	Protospacer
 .************..**********

622. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
aaacgccggtaccgttggtggcgccgga	Protospacer
.. *******.********* ******.

623. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ctccgccggtgccgctgttgccgccgtc	Protospacer
  ************.** ********

624. spacer 6.14|2379207|28|NC_020133|CRT matches to MK816297 (Pseudomonas virus PBPA162, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgttgccgccgcccac	Protospacer
 **************** .****** .

625. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_DQ996271 (Burkholderia glumae BGR1 plasmid pBGF3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gcgcgccggcgctgttggtgccgccgaa	Protospacer
*  ******.**.*************..

626. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgaggccgatgccgtcggtgccgccggt	Protospacer
 *  ****.******.***********

627. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP039632 (Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgatgccggtggcgtcggtgccgccggt	Protospacer
 * .******* ***.***********

628. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP039632 (Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgatgccggtggcgtcggtgccgccggt	Protospacer
 * .******* ***.***********

629. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tggcgacgatgccgttggtgccgccgtc	Protospacer
 * ** **.*****************

630. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccggtgacgttgctgccgatcga	Protospacer
*********** ***** ***** . *.

631. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP021919 (Sagittula sp. P11 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgaggccgatgccgctggtgccgccggt	Protospacer
 *  ****.*****.************

632. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggctgccggtgccgctggtgccgggccg	Protospacer
***.**********.********    *

633. spacer 6.14|2379207|28|NC_020133|CRT matches to LT635659 (Aeromonas veronii plasmid 9716_6_27, strain 9716_6_27) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccggtgccgttcgtgtcgtggtc	Protospacer
**************** ***.**. *

634. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccggcggtgacgttggtgccgacccc	Protospacer
***** ***** *********** *

635. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccgatgccgtgggtgccgaactg	Protospacer
********.****** *******    *

636. spacer 6.14|2379207|28|NC_020133|CRT matches to MT889397 (Mycobacterium phage OfUltron, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgctggtgccgttgctgccgccgct	Protospacer
 * ***.********** ********

637. spacer 6.14|2379207|28|NC_020133|CRT matches to MT889396 (Mycobacterium phage Seabastian, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgctggtgccgttgctgccgccgct	Protospacer
 * ***.********** ********

638. spacer 6.14|2379207|28|NC_020133|CRT matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

639. spacer 6.14|2379207|28|NC_020133|CRT matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

640. spacer 6.14|2379207|28|NC_020133|CRT matches to MG872831 (Mycobacterium phage Asriel, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

641. spacer 6.14|2379207|28|NC_020133|CRT matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgct	Protospacer
 *.***.********** ********

642. spacer 6.14|2379207|28|NC_020133|CRT matches to MT133562 (Pseudomonas phage willy, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

643. spacer 6.14|2379207|28|NC_020133|CRT matches to MT491206 (Pseudomonas phage vB_PaeM_USP_3, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

644. spacer 6.14|2379207|28|NC_020133|CRT matches to MT491205 (Pseudomonas phage vB_PaeM_USP_2, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

645. spacer 6.14|2379207|28|NC_020133|CRT matches to MH399778 (Mycobacterium phage Icee, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

646. spacer 6.14|2379207|28|NC_020133|CRT matches to MT119368 (Pseudomonas phage shane, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

647. spacer 6.14|2379207|28|NC_020133|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

648. spacer 6.14|2379207|28|NC_020133|CRT matches to JF937106 (Mycobacterium phage SirDuracell, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

649. spacer 6.14|2379207|28|NC_020133|CRT matches to LC472881 (Pseudomonas phage R12 DNA, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

650. spacer 6.14|2379207|28|NC_020133|CRT matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgct	Protospacer
 *.***.********** ********

651. spacer 6.14|2379207|28|NC_020133|CRT matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

652. spacer 6.14|2379207|28|NC_020133|CRT matches to MG872832 (Mycobacterium phage Barbarian, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

653. spacer 6.14|2379207|28|NC_020133|CRT matches to MN586032 (Mycobacterium phage Command613, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

654. spacer 6.14|2379207|28|NC_020133|CRT matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

655. spacer 6.14|2379207|28|NC_020133|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

656. spacer 6.14|2379207|28|NC_020133|CRT matches to MN586013 (Mycobacterium phage Traaww1, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

657. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

658. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgct	Protospacer
 *.***.********** ********

659. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgtt	Protospacer
 *.***.********** ********

660. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

661. spacer 6.14|2379207|28|NC_020133|CRT matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

662. spacer 6.14|2379207|28|NC_020133|CRT matches to MN428051 (Mycobacterium phage Modragons, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgctggtgccgttgctgccgccgct	Protospacer
 * ***.********** ********

663. spacer 6.14|2379207|28|NC_020133|CRT matches to MK318076 (Pseudomonas phage vB_PaeM_fHoPae01, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

664. spacer 6.14|2379207|28|NC_020133|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgtt	Protospacer
 *.***.********** ********

665. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_028923 (Mycobacterium phage Llama, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggcgctggtgccgttgctgccgccgct	Protospacer
 * ***.********** ********

666. spacer 6.14|2379207|28|NC_020133|CRT matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

667. spacer 6.14|2379207|28|NC_020133|CRT matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgct	Protospacer
 *.***.********** ********

668. spacer 6.14|2379207|28|NC_020133|CRT matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgtt	Protospacer
 *.***.********** ********

669. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_028785 (Mycobacterium phage NelitzaMV, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

670. spacer 6.14|2379207|28|NC_020133|CRT matches to MT491204 (Pseudomonas phage vB_PaeM_USP_1, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

671. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgct	Protospacer
 *.***.********** ********

672. spacer 6.14|2379207|28|NC_020133|CRT matches to EU816591 (Mycobacterium phage Kostya, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgctgccgccgct	Protospacer
 *.***.********** ********

673. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_042080 (Pseudomonas phage vB_PaeM_E215, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
gaacgccggtgccgatggtggcgccgac	Protospacer
*. *********** ***** *****.

674. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgtcgctggtgccgttgttgccgccgtt	Protospacer
 *.***.********** ********

675. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tgtcgccggtggccttggtgccgccgac	Protospacer
 *.******** * ************.

676. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cccggccgatgccgctggtgccgccggt	Protospacer
  * ****.*****.************

677. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccggtgacgttgctgccgatcga	Protospacer
*********** ***** ***** . *.

678. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccggtgacgttgctgccgatcga	Protospacer
*********** ***** ***** . *.

679. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgccggtgacgttgctgccgatcga	Protospacer
*********** ***** ***** . *.

680. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgacgatgccgttggtgccggtgaa	Protospacer
***** **.************** .*..

681. spacer 6.14|2379207|28|NC_020133|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

682. spacer 6.14|2379207|28|NC_020133|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

683. spacer 6.14|2379207|28|NC_020133|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

684. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

685. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

686. spacer 6.14|2379207|28|NC_020133|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

687. spacer 6.14|2379207|28|NC_020133|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.786 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cggtgccggtgccggtggtgccgacggt	Protospacer
 * .********** ******** ***

688. spacer 13.2|3825099|25|NC_020133|CRT matches to CP027674 (Escherichia coli strain 2014C-3003 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.76 

gacgcctggctgttcggcagcggcg	CRISPR spacer
cgattctggctgttcggcagcggca	Protospacer
 .  .*******************.

689. spacer 13.2|3825099|25|NC_020133|CRT matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 6, identity: 0.76 

gacgcctggctgttcggcagcggcg	CRISPR spacer
cgattctggctgttcggcagcggca	Protospacer
 .  .*******************.

690. spacer 13.6|3825294|25|NC_020133|CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 6, identity: 0.76 

aatggcggcagcgccgggctggtcg	CRISPR spacer
gtccccggcagcgccgggctggtca	Protospacer
. .  *******************.

691. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

acccgg--ggcagacggccaagcgggcgggctgc	CRISPR spacer
--ccggcctgcagacggccgggcgggcgggcttc	Protospacer
  ****   **********..*********** *

692. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggcgacgacgccgggctgctcgcg	Protospacer
 *******.***************  .

693. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggcgacgacgccgggctgctcgcg	Protospacer
 *******.***************  .

694. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018469 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

695. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017192 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

696. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ctacggcggcgacgcctggctgctgacc	Protospacer
   ************* ******** .*

697. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ccgcggcgccgacgacgggctgctgttg	Protospacer
   ***** ***** ************

698. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020986 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6992 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

699. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020986 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6992 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

700. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcttcgacgccgggctgctccag	Protospacer
*******  *************** .

701. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018857 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

702. spacer 18.5|5896958|28|NC_020133|CRT matches to CP030168 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
aagcggcggcgacgccgatctgctgttg	Protospacer
.. **************. ********

703. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcttcgacgccgggctgctccag	Protospacer
*******  *************** .

704. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP021017 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6991 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

705. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020982 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6989 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

706. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012061 (Xanthomonas sp. ISO98C4 plasmid pNX59, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

707. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020990 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6996R plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

708. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018730 (Xanthomonas gardneri strain JS749-3 plasmid pJS749-3.2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

709. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020980 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6988R plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

710. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012058 (Xanthomonas phaseoli pv. phaseoli strain ISO98C12 plasmid pXap59, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

711. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012064 (Xanthomonas phaseoli pv. phaseoli strain ISO18C8 plasmid pXap59, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

712. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012049 (Xanthomonas phaseoli pv. phaseoli strain ISO18C2 plasmid pXap59, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

713. spacer 18.5|5896958|28|NC_020133|CRT matches to AP019683 (Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgtta	Protospacer
 . **************. ********

714. spacer 18.5|5896958|28|NC_020133|CRT matches to AP019683 (Xanthomonas campestris pv. campestris MAFF106712 pXcc1 plasmid DNA, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

715. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018727 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

716. spacer 18.5|5896958|28|NC_020133|CRT matches to MT498043 (Arthrobacter phage Jinkies, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cccgatcggcgacggcgggctgctgttc	Protospacer
  * . ******** *************

717. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018474 (Xanthomonas perforans strain LH3 plasmid pLH3.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

718. spacer 18.5|5896958|28|NC_020133|CRT matches to CP020972 (Xanthomonas axonopodis pv. phaseoli strain CFBP6546R plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

719. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017325 (Xanthomonas campestris pv. campestris str. CN15 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

720. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017325 (Xanthomonas campestris pv. campestris str. CN15 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgtta	Protospacer
 . **************. ********

721. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018465 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.4, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

722. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP031608 (Xanthomonas hortorum strain VT106 plasmid pVT106, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

723. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020984 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6990 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

724. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020984 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6990 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

725. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccgccggcgacgccgagctgctccgg	Protospacer
***** ***********.****** .

726. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018853 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

727. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP034656 (Xanthomonas campestris pv. musacearum NCPPB 4379 plasmid pXCM49, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
aagcggcggcgacgccgatctgctgttg	Protospacer
.. **************. ********

728. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP034656 (Xanthomonas campestris pv. musacearum NCPPB 4379 plasmid pXCM49, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
aagcggcggcgacgccgatctgctgttg	Protospacer
.. **************. ********

729. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020968 (Xanthomonas phaseoli pv. phaseoli strain CFBP6164 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

730. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_LN811400 (Xanthomonas campestris pv. campestris isolate B-1459 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

731. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP021019 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

732. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP021022 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pG, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

733. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgacgaagggctgcaactg	Protospacer
**************  ******* ..*

734. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017318 (Xanthomonas campestris pv. campestris str. CN14 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgtta	Protospacer
 . **************. ********

735. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017318 (Xanthomonas campestris pv. campestris str. CN14 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

736. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP023160 (Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

737. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_007506 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

738. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP017023 (Xanthomonas citri pv. malvacearum strain MSCT plasmid pMSCT60kb, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

739. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_020798 (Xanthomonas axonopodis Xac29-1 plasmid pXAC47, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

740. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020988 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6994R plasmid pA, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

741. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018734 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cagcggcggcgacgccgatctgctgtta	Protospacer
 . **************. ********

742. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP018734 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
tagcggcggcgacgccgatctgctgttg	Protospacer
 . **************. ********

743. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_010879 (Burkholderia glumae strain BGR1 plasmid pBGF2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggcgacggcgagctgctcaag	Protospacer
************** **.******

744. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_019397 (Gluconobacter oxydans H24 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ttcctgcggcgacgccgagctgctggcc	Protospacer
  ** ************.******* .*

745. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcggtgacgccgggctattggaa	Protospacer
*********.***********..**

746. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggcggcgacgccgtgctggacctc	Protospacer
 **************** ****   .**

747. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gaagtgcggcgaggccgggctgctgtgc	Protospacer
*.   ******* ************* *

748. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ccgcggcggcgacgtcgcgctgctgtac	Protospacer
   ***********.** ******** *

749. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgccctgctgctgaac	Protospacer
 .**************  *******  *

750. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gtccggcggtgacgccgggctactggaa	Protospacer
* *******.***********.***

751. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ttcctgcggcgacgccgagctgctggcc	Protospacer
  ** ************.******* .*

752. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgccctgctgctgacc	Protospacer
 .**************  ******* .*

753. spacer 18.5|5896958|28|NC_020133|CRT matches to AP014351 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gaccggcagcgatgccgggctgctgaag	Protospacer
*.*****.****.************

754. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggccgcgacgccgggccgctcgcc	Protospacer
 ****** ************.***  .*

755. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ctccggcggcgaggccgggcggctggtg	Protospacer
  ********** ******* **** *

756. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gcccggcggtgacgccgggctactggaa	Protospacer
* *******.***********.***

757. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgccctgctgctgaac	Protospacer
 .**************  *******  *

758. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
taccggcggcgacgccgggcgtctggcc	Protospacer
 .******************  *** .*

759. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcggcgccgggctgatgaac	Protospacer
 .*********.********** **  *

760. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gtccggcggtgacgccgggctactggaa	Protospacer
* *******.***********.***

761. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_023600 (Mycobacterium phage Jolie1, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cggcggcgtcgtcgccgggctgctgtcg	Protospacer
 * ***** ** **************.

762. spacer 18.5|5896958|28|NC_020133|CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cggcggcgtcgtcgccgggctgctgtcg	Protospacer
 * ***** ** **************.

763. spacer 18.5|5896958|28|NC_020133|CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cggcggcgtcgtcgccgggctgctgtcg	Protospacer
 * ***** ** **************.

764. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 6, identity: 0.786 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cggcggcgtcgtcgccgggctgctgtcg	Protospacer
 * ***** ** **************.

765. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.824 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
caacggcggcaacgacgtgctggtcggcaccctg	Protospacer
**************.*******.****** *

766. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.824 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cgaaaccggcgacggcgtgctgatcgtcaacggc	Protospacer
*.* . ****.*************** *******

767. spacer 18.12|5897327|34|NC_020133|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.824 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cggcggcggcaacgacgtgctgatcggcggcgac	Protospacer
*..***********.*************..**.*

768. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gcggatcggcggcatttccggcggcccc	Protospacer
   ********** ***********  *

769. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gcggatcggcggcatttccggcggcccc	Protospacer
   ********** ***********  *

770. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gcggatcggcggcatttccggcggcccc	Protospacer
   ********** ***********  *

771. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gcggatcggcggcatttccggcggcccc	Protospacer
   ********** ***********  *

772. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cgcgatcggcggctattccgtcggcctg	Protospacer
.************* ***** ****

773. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP033874 (Caulobacter sp. FWC26 plasmid p2) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ttcgatgcgcggcttttccggcggctcg	Protospacer
* ****  *****************

774. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ccccgtcgggcgcttttccggcggcaac	Protospacer
. * .****  *****************

775. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
tgcgatccgcggctttgccggcgctcgc	Protospacer
******* ******** ****** . .*

776. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ggaaatcggcggctttgccggcgtcaat	Protospacer
 * .************ ****** ***.

777. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 6, identity: 0.786 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gttgagcggccgcttttccggcggcagc	Protospacer
  .** **** ***************.*

778. spacer 19.5|6033370|28|NC_020133|CRT matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ggggtcgggcggcgggccggggggcgga	Protospacer
 ***** ********* ********..

779. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP016441 (Bordetella pseudohinzii strain HI4681 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtcc---ggcggcggggcggggggcaac	CRISPR spacer
---gcctgcaggcggcggggcggggggcaag	Protospacer
   *.*.   ********************

780. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgggaccggcggcgcggcgggggggtgt	Protospacer
**** ********* *********  ..

781. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tctgaccggcggcggggcggcgggcaat	Protospacer
.  * *************** ******.

782. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ctccaccggcggcggggcggcgggcatc	Protospacer
*    *************** ***** *

783. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggttcgggcggcggggcgggggccggg	Protospacer
*** ** **************** *..

784. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggttcgggcggcggggcgggggccggg	Protospacer
*** ** **************** *..

785. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggggccggcggcgcggcgggggaatcc	Protospacer
**** ********* ********.   *

786. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ctccaccggcggcggggcggcgggcatc	Protospacer
*    *************** ***** *

787. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggg-----gggcaac	CRISPR spacer
cgggtccggcggcggggccggtttgcgg-----	Protospacer
****************** **     **

788. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP010760 (Phaeobacter inhibens strain P80 plasmid pP80_d, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcagggcagggggcttg	Protospacer
* ***********.****.******

789. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP010603 (Phaeobacter inhibens strain P83 plasmid pP83_d, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcagggcagggggcttg	Protospacer
* ***********.****.******

790. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP010709 (Phaeobacter inhibens strain P66 plasmid pP66_d, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ccggtccggcggcagggcagggggcttg	Protospacer
* ***********.****.******

791. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ctccaccggcggcggggcggcgggcatc	Protospacer
*    *************** ***** *

792. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP041043 (Paracoccus sp. AK26 plasmid pAK3, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgggtccagcggcggggcaggggcggcc	Protospacer
*******.**********.****  . *

793. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgagtccggcggccgggcgggggtcgcg	Protospacer
**.********** ********* *.

794. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_011041 (Escherichia coli bacteriophage rv5, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

795. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_022323 (Escherichia phage 2 JES-2013, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

796. spacer 19.5|6033370|28|NC_020133|CRT matches to MG065635 (UNVERIFIED: Campylobacter phage C12, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

797. spacer 19.5|6033370|28|NC_020133|CRT matches to MH491969 (Escherichia phage LL12, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

798. spacer 19.5|6033370|28|NC_020133|CRT matches to KP869103 (Escherichia coli O157 typing phage 5, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

799. spacer 19.5|6033370|28|NC_020133|CRT matches to KP869102 (Escherichia coli O157 typing phage 4, partial genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

800. spacer 19.5|6033370|28|NC_020133|CRT matches to KJ190158 (Escherichia phage vB_EcoM_FFH2, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cctctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

801. spacer 19.5|6033370|28|NC_020133|CRT matches to MG065653 (UNVERIFIED: Campylobacter phage C14, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cccctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

802. spacer 19.5|6033370|28|NC_020133|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggggccggcggcgcggcgggggaatcc	Protospacer
**** ********* ********.   *

803. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
ctccaccggcggcggggcggcgggcatc	Protospacer
*    *************** ***** *

804. spacer 19.5|6033370|28|NC_020133|CRT matches to MK524525 (Mycobacterium phage Ringer, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cctggtcggcggcggggcgggtggcaag	Protospacer
*  * .*************** *****

805. spacer 19.5|6033370|28|NC_020133|CRT matches to MH752840 (Escherichia phage vB_EcoM-Pr121LW, complete genome) position: , mismatch: 6, identity: 0.786 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cctctccggcggcggggagggggtcaat	Protospacer
*   ************* ***** ***.

806. spacer 19.8|6033514|25|NC_020133|CRT matches to MT664984 (Xanthomonas phage Xp12, complete genome) position: , mismatch: 6, identity: 0.76 

aggcgccggcggggcgggcggactg	CRISPR spacer
cagcgccggcggggcgggcggctcc	Protospacer
 .******************* ..

807. spacer 2.8|706693|36|NC_020133|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 7, identity: 0.806 

-ccgaatccgacgttgtagtcgccgaggttggacgag	CRISPR spacer
gccttggccg-cgttgtaggcgacgaggttggacgag	Protospacer
 **  . *** ******** ** **************

808. spacer 3.11|907478|24|NC_020133|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 7, identity: 0.708 

accggtggcaccggtaccaccgtc	CRISPR spacer
gacggcggtaccggtggcaccggc	Protospacer
. ***.**.******. ***** *

809. spacer 3.13|907580|36|NC_020133|CRT matches to NZ_CP024428 (Paracoccus yeei strain TT13 plasmid pTT13-6, complete sequence) position: , mismatch: 7, identity: 0.806 

ccccaagccggtgaccacggtgccgttgccggcgtt	CRISPR spacer
caccggggcggtgaccacggtgccgctgccggtgtc	Protospacer
* **..* *****************.******.**.

810. spacer 3.13|907580|36|NC_020133|CRT matches to NZ_CP020446 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.806 

ccccaagccggtgaccacggtgccgttgccggcgtt	CRISPR spacer
caccggggcggtgaccacggtgccgctgccggtgtc	Protospacer
* **..* *****************.******.**.

811. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

812. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

813. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

814. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

815. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

816. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

817. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

818. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

819. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

820. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

821. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

822. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

823. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

824. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

825. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

826. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

827. spacer 4.9|1145423|33|NC_020133|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

828. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

829. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

830. spacer 4.9|1145423|33|NC_020133|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

831. spacer 4.9|1145423|33|NC_020133|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

832. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

833. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

834. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

835. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

836. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

837. spacer 4.9|1145423|33|NC_020133|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

838. spacer 4.9|1145423|33|NC_020133|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

839. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

840. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

841. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

842. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

843. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

844. spacer 4.9|1145423|33|NC_020133|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

845. spacer 4.9|1145423|33|NC_020133|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

846. spacer 4.9|1145423|33|NC_020133|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

847. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

848. spacer 4.9|1145423|33|NC_020133|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

849. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

850. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

851. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

852. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

853. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

854. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

855. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

856. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

857. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

858. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

859. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

860. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

861. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

862. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

863. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

864. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

865. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

866. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

867. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

868. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

869. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

870. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

871. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

872. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

873. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

874. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

875. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

876. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

877. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

878. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

879. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

880. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

881. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

882. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

883. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

884. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

885. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

886. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

887. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

888. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

889. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

890. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

891. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

892. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

893. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

894. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

895. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

896. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

897. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

898. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

899. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

900. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

901. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

902. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

903. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

904. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

905. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

906. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

907. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

908. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

909. spacer 4.9|1145423|33|NC_020133|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

910. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

911. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

912. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

913. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

914. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

915. spacer 4.9|1145423|33|NC_020133|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

916. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

917. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

918. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

919. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

920. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

921. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

922. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

923. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

924. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

925. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

926. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

927. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

928. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

929. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

930. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

931. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

932. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

933. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

934. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

935. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

936. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

937. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

938. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

939. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

940. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

941. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

942. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

943. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

944. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

945. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

946. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

947. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

948. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

949. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

950. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

951. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

952. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

953. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

954. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

955. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

956. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctggcgccggcg	Protospacer
 *   *.*********** ***** ********

957. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

958. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

959. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

960. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctcggcaagctgctgcccgcgctggcgccggcg	Protospacer
.*   *.*********** ***** ********

961. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
ctgcccgcgctgctgccgccgctgctggaagcg	Protospacer
.****** ********* *******.*  .***

962. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atcggcaagctgctgcccgcgctgtcgccggcg	Protospacer
 *   *.*********** *****.********

963. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcacgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

964. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcatgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

965. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcatgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

966. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcatgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

967. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcatgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

968. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.788 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atgttcatgccgccgcccccgctgccgccggcg	Protospacer
 **..*. **.**.*******************

969. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgcgccgttgccgccgttgccgccgtt	Protospacer
.  .******** *****.********.

970. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
catgctcgttgcggccgtcgccgccgca	Protospacer
.*.  .********************.

971. spacer 6.4|2378526|28|NC_020133|CRT matches to CP003951 (Rhodococcus opacus PD630 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gcgaggcgttgcggccgtcgccgccgat	Protospacer
    * ******************** .

972. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctgtgccattgcggccgtcgccgccaga	Protospacer
.  ****.*****************.

973. spacer 6.4|2378526|28|NC_020133|CRT matches to MH338241 (Mycobacterium phage Tarynearal, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgtcgccgttgccgccgtcgccgccgcg	Protospacer
....******** *************.

974. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cactgcggtcgcggccgtcgccgcgacg	Protospacer
.***** **.************** ..

975. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgtggcgttgcgcccgtcgccgccgcg	Protospacer
.  ** ******* ************.

976. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgccgccgttgcggccgtcgctgccaag	Protospacer
..*.*****************.***.

977. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgccgccgttgcggccgtcgcggccaag	Protospacer
..*.***************** ***.

978. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgtggcgttgcgcccgtcgccgccgcg	Protospacer
.  ** ******* ************.

979. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021832 (Sinorhizobium meliloti strain HM006 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggttgccggtgcggccgacgccgccgcg	Protospacer
 ..***** ******** ********.

980. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
acctgccggtgccgccgtcgccgcccag	Protospacer
  ****** *** ************

981. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP026529 (Sinorhizobium meliloti strain AK21 plasmid pSmeAK21b, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ggttgccggtgcggccgacgccgccgcg	Protospacer
 ..***** ******** ********.

982. spacer 6.4|2378526|28|NC_020133|CRT matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

983. spacer 6.4|2378526|28|NC_020133|CRT matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

984. spacer 6.4|2378526|28|NC_020133|CRT matches to MK112547 (Gordonia phage Maridalia, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

985. spacer 6.4|2378526|28|NC_020133|CRT matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

986. spacer 6.4|2378526|28|NC_020133|CRT matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

987. spacer 6.4|2378526|28|NC_020133|CRT matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

988. spacer 6.4|2378526|28|NC_020133|CRT matches to MT521999 (Gordonia Phage Jablanski, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

989. spacer 6.4|2378526|28|NC_020133|CRT matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
tactgccggtgcggccgccgccggtacg	Protospacer
******** ********.***** ...

990. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP021360 (Acidovorax carolinensis strain NA2 plasmid pACNA2.1, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgtggcgttgcgcccgtcgccgccgcg	Protospacer
.  ** ******* ************.

991. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
aagatgcgtcgcggccgtcgccgccgtt	Protospacer
 *    ***.*****************.

992. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ctacaccgtcgcggccatcgccgccgtc	Protospacer
.  ..****.******.***********

993. spacer 6.4|2378526|28|NC_020133|CRT matches to KT783672 (Arthrobacter phage TymAbreu, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

994. spacer 6.4|2378526|28|NC_020133|CRT matches to MF140420 (Arthrobacter phage Mariposa, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

995. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576951 (Arthrobacter phage Copper, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

996. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576955 (Arthrobacter phage Hunnie, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

997. spacer 6.4|2378526|28|NC_020133|CRT matches to KT355475 (Arthrobacter phage Sandman, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

998. spacer 6.4|2378526|28|NC_020133|CRT matches to KX576642 (Arthrobacter phage Massimo, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

999. spacer 6.4|2378526|28|NC_020133|CRT matches to KX610765 (Arthrobacter phage Prospero, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1000. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160670 (Arthrobacter phage Toulouse, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1001. spacer 6.4|2378526|28|NC_020133|CRT matches to NC_028692 (Arthrobacter phage Decurro, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1002. spacer 6.4|2378526|28|NC_020133|CRT matches to MN813695 (Arthrobacter phage LouisXIV, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1003. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576950 (Arthrobacter phage CGermain, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1004. spacer 6.4|2378526|28|NC_020133|CRT matches to MH779506 (Arthrobacter phage Guntur, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1005. spacer 6.4|2378526|28|NC_020133|CRT matches to MF140426 (Arthrobacter phage Seume, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1006. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576948 (Arthrobacter phage Azathoth, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1007. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160655 (Arthrobacter phage Maggie, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1008. spacer 6.4|2378526|28|NC_020133|CRT matches to KT355473 (Arthrobacter phage Jessica, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1009. spacer 6.4|2378526|28|NC_020133|CRT matches to MF140417 (Arthrobacter phage Link, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1010. spacer 6.4|2378526|28|NC_020133|CRT matches to KY434670 (Arthrobacter phage Chestnut, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1011. spacer 6.4|2378526|28|NC_020133|CRT matches to MF140433 (Arthrobacter phage TinoCrisci, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1012. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576957 (Arthrobacter phage Inspire2, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1013. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576961 (Arthrobacter phage Ronnie, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1014. spacer 6.4|2378526|28|NC_020133|CRT matches to KX443695 (Arthrobacter phage Courtney3, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1015. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160674 (Arthrobacter phage Yank, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1016. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160657 (Arthrobacter phage Moloch, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1017. spacer 6.4|2378526|28|NC_020133|CRT matches to KY224000 (Mycobacterium phage Rich, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgtgaccgttaccgccgtcgccgccgtc	Protospacer
... .*****.* ***************

1018. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160658 (Arthrobacter phage Muttlie, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1019. spacer 6.4|2378526|28|NC_020133|CRT matches to MK737943 (Arthrobacter phage Arby, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1020. spacer 6.4|2378526|28|NC_020133|CRT matches to KR080199 (Mycobacterium phage Baee, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cgtgaccgttaccgccgtcgccgccgtc	Protospacer
... .*****.* ***************

1021. spacer 6.4|2378526|28|NC_020133|CRT matches to MH576952 (Arthrobacter phage Dewayne, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1022. spacer 6.4|2378526|28|NC_020133|CRT matches to KU160667 (Arthrobacter phage Stratus, complete genome) position: , mismatch: 7, identity: 0.75 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
ccgggccgttgccgccgtcgccggcgtg	Protospacer
.   ******** ********** ***

1023. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.75 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cctcgatggtgccgccggggccgctcgc	Protospacer
. .** *******************  .

1024. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.75 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
gctggttggtgccgccgtggccgcggta	Protospacer
  . ************* ****** **

1025. spacer 6.5|2378589|28|NC_020133|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.75 

tgccgttggtgccgccggggccgctgtt	CRISPR spacer
cgccgttgaagccgccggggccgcgcgg	Protospacer
.*******. **************

1026. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tctggccggtaccgatggtgccgccggc	Protospacer
  . ******.*** ************

1027. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgacggtgccgttgatgccgggcat	Protospacer
***** ***********.*****   .

1028. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tgccgccggagccgttgttgccgcgtat	Protospacer
 ******** ******* ******  .

1029. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_LR134447 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
agagcgcgttgccgttggtgccgccggt	Protospacer
.*    ** ******************

1030. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
tgccgccggagccgttgttgccgcgtat	Protospacer
 ******** ******* ******  .

1031. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caaagccgatgccgctggtgccgccggt	Protospacer
 .  ****.*****.************

1032. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caacgccggtgccgttgttgtcgccgat	Protospacer
 . ************** **.*****.

1033. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgccggtgccgcgctt	Protospacer
 *************..********

1034. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ccacgccggtggcgttgttgccgccgaa	Protospacer
   ******** ***** ********..

1035. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ccgtgccggagcctttggtgccgccggt	Protospacer
   .***** *** *************

1036. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ccgtgccggagcctttggtgccgccggt	Protospacer
   .***** *** *************

1037. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ccaggccgatgccgctggtgccgccggt	Protospacer
    ****.*****.************

1038. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
cgccgccggtgccgccggtgccgcgctt	Protospacer
 *************..********

1039. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgacggtgccgttgatgccgggcat	Protospacer
***** ***********.*****   .

1040. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
caaggccgatgccgctggtgccgccgga	Protospacer
 .  ****.*****.************.

1041. spacer 6.14|2379207|28|NC_020133|CRT matches to NC_004963 (Mycobacterium celatum plasmid pCLP, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ctgcggcggtgccgttggcgccgccgtc	Protospacer
   ** ************.*******

1042. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
acgcgccggtgccggtggtgccgcgcag	Protospacer
.  *********** *********  .*

1043. spacer 6.14|2379207|28|NC_020133|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccgccggtgccgttggtgccgccggg	CRISPR spacer
ggccgacggtgccgttgatgccgggcat	Protospacer
***** ***********.*****   .

1044. spacer 7.1|2660450|30|NC_020133|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.767 

-ggcattggcattgcggcccaccccgccgac	CRISPR spacer
ctgcg-tggcaatgcggcccgccccgccggt	Protospacer
  **. ***** ********.********..

1045. spacer 7.1|2660450|30|NC_020133|CRISPRCasFinder matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 7, identity: 0.767 

ggcattggcattgcggcccaccccgccgac	CRISPR spacer
gaaaacggcattgcggcccgccccggcgaa	Protospacer
*. * .*************.***** ***

1046. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781 

acccggggcagacggccaagcgggcgggctgc	CRISPR spacer
tcctcgggcagagggccgagcgggcgggcgcc	Protospacer
 **. ******* ****.***********  *

1047. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.781 

acccggggcagacggccaagcgggcgggctgc	CRISPR spacer
tcctcgggcagagggccgagcgggcgggcgcc	Protospacer
 **. ******* ****.***********  *

1048. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP024791 (Nostoc flagelliforme CCNUN1 plasmid pNFSY06, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
cgccgccaaccccagcagcaaccgccccc	Protospacer
  ******* *************.  **

1049. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP025052 (Pseudomonas aeruginosa strain PB353 plasmid pPB353_1, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
cttggccaagccctgcagaaaccaggctg	Protospacer
 .. ********* **** ********.*

1050. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
ccgaccccagcgcagcagcaaccaggccc	Protospacer
 *   ** *** ****************

1051. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP015000 (Pseudomonas aeruginosa strain PA7790 plasmid pPA7790, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
cttggccaagccctgcagaaaccaggctg	Protospacer
 .. ********* **** ********.*

1052. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
ctcgatcaagcccagcatcaaccaggacg	Protospacer
 .* ..*********** ******** **

1053. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NZ_CP049162 (Pseudomonas aeruginosa strain MS14403 plasmid pMS14403A, complete sequence) position: , mismatch: 7, identity: 0.759 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
cttggccaagccctgcagaaaccaggctg	Protospacer
 .. ********* **** ********.*

1054. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1055. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcgcggc	Protospacer
 .************ ********    *

1056. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1057. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gggcggcggcgacgccgggctatctcgc	Protospacer
** ******************... . *

1058. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcgacgacgccgggctcgtcgcg	Protospacer
********.************  *  .

1059. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcgcggc	Protospacer
 .************ ********    *

1060. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcgcggc	Protospacer
 .************ ********    *

1061. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1062. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1063. spacer 18.5|5896958|28|NC_020133|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1064. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1065. spacer 18.5|5896958|28|NC_020133|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1066. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggccggcgacgacgccgggctcgtcgcg	Protospacer
********.************  *  .

1067. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggcggcgacgccgtgctgacgggt	Protospacer
 **************** **** .*  .

1068. spacer 18.5|5896958|28|NC_020133|CRT matches to MH809532 (Burkholderia phage phiE131, complete genome) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccgccggcgacgccgagctgctcaag	Protospacer
 **** ***********.******

1069. spacer 18.5|5896958|28|NC_020133|CRT matches to MH809533 (Burkholderia phage phiE058, complete genome) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccgccggcgacgccgagctgctcaag	Protospacer
 **** ***********.******

1070. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ggacggcggcgaagccgggctgcacccg	Protospacer
** ********* **********  ..

1071. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ttccggcggcgccgccgagctgctgcgt	Protospacer
  ********* *****.*******. .

1072. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1073. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcggggt	Protospacer
 .************ ******** *  .

1074. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcgcggc	Protospacer
 .************ ********    *

1075. spacer 18.11|5897276|31|NC_020133|CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

cgccggtggcgagagcttcggtttcggtgcg	CRISPR spacer
ctcgatcggcgagagcggcggtttcggtgcg	Protospacer
* * . .*********  *************

1076. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 7, identity: 0.794 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
aggcgctggcaacgacgttctgatcggcaacggc	Protospacer
 ..** .*******.*** ***************

1077. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 7, identity: 0.794 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cggcgcgggcaacgacgagctgatcggcaacggt	Protospacer
*..**  *******.** ***************.

1078. spacer 18.12|5897327|34|NC_020133|CRT matches to MH230879 (Mycobacterium phage Xavia, complete genome) position: , mismatch: 7, identity: 0.794 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
taacggcggcaacggcgtgatcatcggtgtcggg	Protospacer
.****************** * *****.. ***

1079. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 7, identity: 0.794 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cgagggcggcaacgacgtgctggtcggccaggac	Protospacer
*.* **********.*******.***** * *.*

1080. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gtggatcgtcggcttttccggccgcacg	Protospacer
   ***** ************* ***

1081. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cgcgatcgtcggcttttccggctccggg	Protospacer
.******* *************  *..

1082. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
aaccatcggcggcttttccgccggcgct	Protospacer
 .* **************** ****. .

1083. spacer 19.4|6033322|28|NC_020133|CRT matches to KY653127 (Corynebacterium phage IME1320_01, complete genome) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cgaaatcagcggcttttccggcggcgtt	Protospacer
.* .***.*****************. .

1084. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ctatctcggcggcatttccggcggctac	Protospacer
.    ******** *********** **

1085. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gacgattggcgggttttccggcggcgtg	Protospacer
 .****.***** ************.

1086. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ggcgatcggcggcttctccggcctggat	Protospacer
 **************.******   .*.

1087. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
gtggatcgtcggcttttccggccgcacg	Protospacer
   ***** ************* ***

1088. spacer 19.4|6033322|28|NC_020133|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
cttcttcggcggattttccggcggccac	Protospacer
. .  ******* ************ **

1089. spacer 19.4|6033322|28|NC_020133|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 7, identity: 0.75 

tgcgatcggcggcttttccggcggcaac	CRISPR spacer
ctatctcggcggcatttccggcggctac	Protospacer
.    ******** *********** **

1090. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP019460 (Streptomyces autolyticus strain CGMCC0516 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
gcgggccgggggcggggcggggggccgg	Protospacer
  ** **** *************** .

1091. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tcggtccggtggcggggcgggcggcggg	Protospacer
. *******.*********** ***..

1092. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cgggtccggcggcggggccggcaccctg	Protospacer
****************** ** . *

1093. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tcggtccggtggcggggcgggcggcggg	Protospacer
. *******.*********** ***..

1094. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
tcggtccggtggcggggcgggcggcggg	Protospacer
. *******.*********** ***..

1095. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggggccggcggcggggcggtggaggcg	Protospacer
**** *************** **. .

1096. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
cggggccggcggcggggcggtggaggcg	Protospacer
**** *************** **. .

1097. spacer 19.5|6033370|28|NC_020133|CRT matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.75 

cgggtccggcggcggggcggggggcaac	CRISPR spacer
accctccggcggcgcggcgcggggcaag	Protospacer
    ********** **** *******

1098. spacer 19.7|6033460|34|NC_020133|CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 7, identity: 0.794 

tggca-ccgggggtgagggaaccgccggcagcggt	CRISPR spacer
-ggcagccgggggtgaggagaccgccggcaaaagg	Protospacer
 **** ************..**********. .*

1099. spacer 4.8|1145369|30|NC_020133|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733 

aactgccccgcacctccagtgccaccggac	CRISPR spacer
cgatcccccgcacctccagcaccaccggcg	Protospacer
 . * **************..*******

1100. spacer 4.8|1145369|30|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733 

aactgccccgcacctccagtgccaccggac	CRISPR spacer
gcgctcgccggacctccagcgccaccggac	Protospacer
.  . * *** ********.**********

1101. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
gagcgggagctgctgcccctgctgctgccgggc	Protospacer
  **  *************.*****.*****

1102. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 8, identity: 0.758 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
atattcacgccgccgcccccgctgccgccggcg	Protospacer
 *...*. **.**.*******************

1103. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 8, identity: 0.758 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
gtgcccgagctgctgcgctcgctgcgcgccgtg	Protospacer
 *************** *.******   * *.*

1104. spacer 4.9|1145423|33|NC_020133|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 8, identity: 0.758 

ttgcccgagctgctgcccccgctgccgccggcg-----	CRISPR spacer
gtgcccgagctgctggccgcgctgc-----gcgaccag	Protospacer
 ************** ** ******     ***

1105. spacer 6.4|2378526|28|NC_020133|CRT matches to MH572335 (Microviridae sp. isolate SD_SC_90, complete genome) position: , mismatch: 8, identity: 0.714 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
gttgatcgttgcggccgtcgccgccgag	Protospacer
  . ..********************

1106. spacer 6.4|2378526|28|NC_020133|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.714 

tactgccgttgcggccgtcgccgccgtc	CRISPR spacer
cggggccgtcgcggccgtcgccgcccgg	Protospacer
..  *****.***************

1107. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

acccggggcagacggccaagcgggcgggctgc--	CRISPR spacer
cggcggggcaggcggccaagcaggc--gccgcag	Protospacer
   ********.*********.***  **.**

1108. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

acccggggcagacggccaagcgggcgggctgc--	CRISPR spacer
cggcggggcaggcggccaagcaggc--gccgcag	Protospacer
   ********.*********.***  **.**

1109. spacer 15.1|5186089|32|NC_020133|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75 

acccggggcagacggccaagcgggcgggctgc--	CRISPR spacer
cggcggggcaggcggccaagcaggc--gccgcag	Protospacer
   ********.*********.***  **.**

1110. spacer 15.3|5186221|29|NC_020133|CRISPRCasFinder matches to NC_006571 (Streptomyces albulus plasmid pNO33 DNA, complete sequence) position: , mismatch: 8, identity: 0.724 

acccgccaagcccagcagcaaccaggccg	CRISPR spacer
cgtgaccaaggccagcagccaccaggcca	Protospacer
  . .***** ******** ********.

1111. spacer 15.4|5186275|38|NC_020133|CRISPRCasFinder matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 8, identity: 0.789 

-gttgctgttcggcaacggcggagccggcggcaccgggg	CRISPR spacer
cgatgcc-ctgagcaacggcggagccggcggcaacgtgg	Protospacer
 * ***. .* .********************* ** **

1112. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggccgcgacgccgggctgggcgca	Protospacer
 ****** **************    .

1113. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggccgcgacgccgggctgggcgca	Protospacer
 ****** **************    .

1114. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP048816 (Caulobacter rhizosphaerae strain KCTC 52515 plasmid unnamed) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
cgccggcggcgacgccggtctggacgaa	Protospacer
 ***************** ***

1115. spacer 18.5|5896958|28|NC_020133|CRT matches to MN234176 (Mycobacterium phage Yuna, complete genome) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
ccgaggcgccgacgccgggctgctggaa	Protospacer
    **** ****************

1116. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
caccggcggcgacgacgggctgcgcggg	Protospacer
 .************ ********

1117. spacer 18.5|5896958|28|NC_020133|CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 8, identity: 0.714 

ggccggcggcgacgccgggctgctgttc	CRISPR spacer
atccggcagcgacgccgggctgccagga	Protospacer
. *****.***************..

1118. spacer 18.8|5897105|37|NC_020133|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.784 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctccgtcggcgcggccgtcgccatgaacgacgtcgac	Protospacer
  * * **************** * **********.

1119. spacer 18.8|5897105|37|NC_020133|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.784 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctccgtcggcgcggccgtcgccatgaacgacgtcgac	Protospacer
  * * **************** * **********.

1120. spacer 18.8|5897105|37|NC_020133|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.784 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctccgtcggcgcggccgtcgccatgaacgacgtcgac	Protospacer
  * * **************** * **********.

1121. spacer 18.8|5897105|37|NC_020133|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.784 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctccgtcggcgcggccgtcgccatgaacgacgtcgac	Protospacer
  * * **************** * **********.

1122. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 8, identity: 0.765 

caacggcggcaacggcgtgctgatcggcaacggc-	CRISPR spacer
ccgcggcggcatcggcgtgctgat-ggggccgacc	Protospacer
* .******** ************ ** . **.*

1123. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.765 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cctgggcggcaacggcacgctgatcggcgccagc	Protospacer
*   ************..**********. *.**

1124. spacer 18.12|5897327|34|NC_020133|CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 8, identity: 0.765 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cgccggcggcaagggcgtgctgctcggcggcgta	Protospacer
*. ********* ********* *****..**

1125. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 8, identity: 0.765 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cggcggcggcaatgacgtgctgatcggccaatcc	Protospacer
*..*********.*.************* *   *

1126. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.765 

-caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
gcgccagc-gcaacagcgtgctgctcggcaacgcg	Protospacer
 *. *.** *****.******** *********

1127. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765 

caacgg-cggcaacggcgtgctgatcggcaacggc	CRISPR spacer
-gccggtcggcaacggcatgctgatcgtcaaggaa	Protospacer
 . *** **********.********* *** *.

1128. spacer 19.9|6033559|34|NC_020133|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1129. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1130. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010685 (Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1131. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1132. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1133. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1134. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1135. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggctctggtgccgccggtggcgcc	Protospacer
.*  . * ******* ****************.*

1136. spacer 19.9|6033559|34|NC_020133|CRT matches to MH697577 (Mycobacterium phage Amochick, complete genome) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
cgcggcgggtgcctccggtgccgccggtgcctcc	Protospacer
**  .****** *** ************* * .*

1137. spacer 19.9|6033559|34|NC_020133|CRT matches to KT246485 (Mycobacterium phage OBUpride, complete genome) position: , mismatch: 8, identity: 0.765 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
cgcggcgggtgcctccggtgccgccggtgcctcc	Protospacer
**  .****** *** ************* * .*

1138. spacer 3.7|907238|33|NC_020133|CRT matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 9, identity: 0.727 

cccggcgccgccatcacctctgatcgcgccgtc	CRISPR spacer
gatcaggccgccatcatctctgatcgcgcccgc	Protospacer
  . . **********.*************  *

1139. spacer 3.7|907238|33|NC_020133|CRT matches to MN657114 (Psychrobacter sp. strain ANT_P52 plasmid pA52P6, complete sequence) position: , mismatch: 9, identity: 0.727 

cccggcgccgccatcacctctgatcgcgccgtc	CRISPR spacer
aatgaagctgccatcgcctctgatcgcgccttg	Protospacer
  .*. **.******.************** *

1140. spacer 3.9|907358|33|NC_020133|CRT matches to NC_012797 (Desulfovibrio magneticus RS-1 plasmid pDMC1, complete sequence) position: , mismatch: 9, identity: 0.727 

gccgctgccgccgttgcctctgaccacgccgtt	CRISPR spacer
cgcgctgccgccgttgccgcagaccagcatctt	Protospacer
  **************** * *****   . **

1141. spacer 4.9|1145423|33|NC_020133|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727 

ttgcccgagctgctgcccccgctgccgccggcg	CRISPR spacer
aaggacaagctgctggccccgctgcagccggac	Protospacer
  *  *.******** ********* *****

1142. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735 

caacggcggcaacggcgtgctgatcggcaacggc-	CRISPR spacer
gcgcggcggcatcggcgtgctgat-ggggccgacc	Protospacer
  .******** ************ ** . **.*

1143. spacer 18.12|5897327|34|NC_020133|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.735 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
tgccggcggcaaggtcgtgctgatcggccaggca	Protospacer
.. ********* * ************* * *

1144. spacer 18.12|5897327|34|NC_020133|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 9, identity: 0.735 

caacggcggcaacggcgtgctgatcggcaacggc-	CRISPR spacer
acgcggcggcatcggcgtgctgat-ggggccgacc	Protospacer
  .******** ************ ** . **.*

1145. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 9, identity: 0.735 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cggcggtggcaacgacgtgctgatcggtggcacc	Protospacer
*..***.*******.************...*. *

1146. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 9, identity: 0.735 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcccgctacggctccggtgccgccggtggcgtc	Protospacer
.* *    ..***** ******************

1147. spacer 19.9|6033559|34|NC_020133|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 9, identity: 0.735 

cggcacgggtggctcgggtgccgccggtggcgtc	CRISPR spacer
tgcagggcgtggccctggtgccgccggtggcgcc	Protospacer
.*  . * *****.* ****************.*

1148. spacer 3.13|907580|36|NC_020133|CRT matches to NZ_CP022370 (Bosea sp. AS-1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.722 

ccccaagccggtgaccacggtgccgttgccggcgtt	CRISPR spacer
gtcggtcgtggtgatcacggtgccgttgccggcatt	Protospacer
 .* .   .*****.******************.**

1149. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cctcaatccgaacggcgtgctgttcggcagcggc	Protospacer
*  *...   ************ ******.****

1150. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cctcaatccgaacggcgtgctgttcggcagcggc	Protospacer
*  *...   ************ ******.****

1151. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
cctcaatccgaacggcgtgctgttcggcagcggc	Protospacer
*  *...   ************ ******.****

1152. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
gcgcggcggcatcggcgtgctgatgggcccgacc	Protospacer
  .******** ************ ***   . *

1153. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
tggcggcggcaacgacctgctgatcgggggcgcg	Protospacer
...***********.* ********** ..**

1154. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
tgccggcggcaaggtcgtgctgatcggtcaggca	Protospacer
.. ********* * ************. * *

1155. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
tgcgggcggcaaggtcgtgctgatcggccaggcg	Protospacer
..  ******** * ************* * *

1156. spacer 18.12|5897327|34|NC_020133|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 10, identity: 0.706 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
tgcgggcggcaaggtcgtgctgatcggccaggcg	Protospacer
..  ******** * ************* * *

1157. spacer 19.9|6033559|34|NC_020133|CRT matches to MT114166 (Microbacterium phage Nike, complete genome) position: , mismatch: 10, identity: 0.706 

cggcacg-ggtggctcgggtgccgccggtggcgtc	CRISPR spacer
-gatgtgctgtggctcgggtgccggcggcggcggt	Protospacer
 *....*  *************** ***.**** .

1158. spacer 19.9|6033559|34|NC_020133|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 10, identity: 0.706 

cggcacg-ggtggctcgggtgccgccggtggcgtc	CRISPR spacer
-gatgtgctgtggctcgggtgccggcggcggcggt	Protospacer
 *....*  *************** ***.**** .

1159. spacer 18.8|5897105|37|NC_020133|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
aatcggcggcgcggcaggcgccctcaacgacagcctc	Protospacer
... *********** * *************. *

1160. spacer 18.8|5897105|37|NC_020133|CRT matches to MK967395 (Mycobacterium phage WideWale, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1161. spacer 18.8|5897105|37|NC_020133|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1162. spacer 18.8|5897105|37|NC_020133|CRT matches to KU297783 (Mycobacterium phage NaSiaTalie, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1163. spacer 18.8|5897105|37|NC_020133|CRT matches to MF919538 (Mycobacterium phage Updawg, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1164. spacer 18.8|5897105|37|NC_020133|CRT matches to MH825701 (Mycobacterium phage Flare16, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1165. spacer 18.8|5897105|37|NC_020133|CRT matches to MK061408 (Mycobacterium phage Centaur, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1166. spacer 18.8|5897105|37|NC_020133|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1167. spacer 18.8|5897105|37|NC_020133|CRT matches to KJ959632 (Mycobacterium phage Equemioh13, complete genome) position: , mismatch: 11, identity: 0.703 

ggcgggcggcgcggccgtcgccctcaacgacgtcgga	CRISPR spacer
ctcatgcggcgcggccgtcgacctcaacaaccggtgg	Protospacer
  *. *************** *******.**    *.

1168. spacer 18.5|5896958|28|NC_020133|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 12, identity: 0.571 

--------ggccggcggcgacgccgggctgctgttc	CRISPR spacer
gtcgtgcagccgggcgtcgacgccggcc--------	Protospacer
        * * **** ********* *

1169. spacer 18.12|5897327|34|NC_020133|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 12, identity: 0.647 

caacggcggcaacggcgtgctgatcggcaacggc	CRISPR spacer
gggcggcggcatcggcgtgctgttcgggtgtcat	Protospacer
 ..******** ********** ****  .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage