Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_006140 Desulfotalea psychrophila LSv54, complete genome 1 crisprs NA 0 0 0 0
NC_006138 Desulfotalea psychrophila LSv54, complete genome 3 crisprs cas8u1,cas3,csb2gr5,cas7,csa3,DEDDh,DinG,cas2,RT,Cas9_archaeal 1 2 2 0
NC_006139 Desulfotalea psychrophila LSv54, complete genome 1 crisprs RT 0 1 0 0

Results visualization

1. NC_006139
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006139_1 70417-70507 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_006139_1 1.1|70445|35|NC_006139|CRISPRCasFinder 70445-70479 35 MT104473 Pseudomonas phage MR13, complete genome 16950-16984 11 0.686
NC_006139_1 1.1|70445|35|NC_006139|CRISPRCasFinder 70445-70479 35 MT104475 Pseudomonas phage MR15, complete genome 16931-16965 11 0.686

1. spacer 1.1|70445|35|NC_006139|CRISPRCasFinder matches to MT104473 (Pseudomonas phage MR13, complete genome) position: , mismatch: 11, identity: 0.686

tttagtgtcagattgccgtcgaaagaggctatctc	CRISPR spacer
ccgtgagtcagtttgccgtcgaaagtggctacact	Protospacer
..  * ***** ************* *****. ..

2. spacer 1.1|70445|35|NC_006139|CRISPRCasFinder matches to MT104475 (Pseudomonas phage MR15, complete genome) position: , mismatch: 11, identity: 0.686

tttagtgtcagattgccgtcgaaagaggctatctc	CRISPR spacer
ccgtgagtcagtttgccgtcgaaagtggctacact	Protospacer
..  * ***** ************* *****. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_006138
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006138_1 52251-52334 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006138_2 198142-199100 Unclear NA
13 spacers
cas8u1,cas3,csb2gr5,cas7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006138_3 748337-748447 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_006138_1 1.1|52278|30|NC_006138|CRISPRCasFinder 52278-52307 30 NC_006138.1 50869-50898 1 0.967
NC_006138_1 1.1|52278|30|NC_006138|CRISPRCasFinder 52278-52307 30 NC_006138.1 54537-54566 1 0.967

1. spacer 1.1|52278|30|NC_006138|CRISPRCasFinder matches to position: 50869-50898, mismatch: 1, identity: 0.967

ggacagggattaaaagttaaccactgctct	CRISPR spacer
ggacagggactaaaagttaaccactgctct	Protospacer
*********.********************

2. spacer 1.1|52278|30|NC_006138|CRISPRCasFinder matches to position: 54537-54566, mismatch: 1, identity: 0.967

ggacagggattaaaagttaaccactgctct	CRISPR spacer
ggacagggactaaaagttaaccactgctct	Protospacer
*********.********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_006138_2 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT 198462-198495 34 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 76621-76654 9 0.735
NC_006138_2 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT 198462-198495 34 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 158977-159010 9 0.735
NC_006138_2 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT 198462-198495 34 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 38471-38504 9 0.735
NC_006138_2 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT 198462-198495 34 NC_014818 Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence 83769-83802 10 0.706
NC_006138_2 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT 198462-198495 34 NZ_AP018829 Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence 288657-288690 10 0.706
NC_006138_2 2.18|198462|35|NC_006138|PILER-CR 198462-198496 35 NZ_CP022748 Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence 76621-76655 10 0.714
NC_006138_2 2.18|198462|35|NC_006138|PILER-CR 198462-198496 35 NZ_CP046256 Sphingobium sp. CAP-1 plasmid p3, complete sequence 158976-159010 10 0.714

1. spacer 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ttcccgagatcggtcaggtcatagacgccaaact---	CRISPR spacer
cgcccgagatcggtaaggtcatggacg---agttcag	Protospacer
. ************ *******.****   *..*   

2. spacer 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.735

ttcccgagatcggtcaggtcatagacgccaaact---	CRISPR spacer
cgcccgagatcggtaaggtcatggacg---agttcag	Protospacer
. ************ *******.****   *..*   

3. spacer 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 9, identity: 0.735

ttcccgagatcggtcaggtcatagacgccaaact	CRISPR spacer
tccccgagatcggccaggttatagacactgcgat	Protospacer
*.***********.*****.******.*.. . *

4. spacer 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT matches to NC_014818 (Asticcacaulis excentricus CB 48 plasmid pASTEX01, complete sequence) position: , mismatch: 10, identity: 0.706

ttcccgagatcggtcaggtcatagacgccaaact	CRISPR spacer
gcccccagatcggtcagggcatagacctgtgtct	Protospacer
 .*** ************ ******* .  . **

5. spacer 2.5|198462|34|NC_006138|CRISPRCasFinder,CRT matches to NZ_AP018829 (Asticcacaulis excentricus strain M6 plasmid pASEM-1, complete sequence) position: , mismatch: 10, identity: 0.706

ttcccgagatcggtcaggtcatagacgccaaact	CRISPR spacer
gcccccagatcggtcagggcatagacctgcgtct	Protospacer
 .*** ************ ******* .  . **

6. spacer 2.18|198462|35|NC_006138|PILER-CR matches to NZ_CP022748 (Sphingobium hydrophobicum strain C1 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.714

ttcccgagatcggtcaggtcatagac--gccaaactg	CRISPR spacer
cgcccgagatcggtaaggtcatggacgagttcagc--	Protospacer
. ************ *******.***  *.. *.*  

7. spacer 2.18|198462|35|NC_006138|PILER-CR matches to NZ_CP046256 (Sphingobium sp. CAP-1 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.714

ttcccgagatcggtcaggtcatagac--gccaaactg	CRISPR spacer
cgcccgagatcggtaaggtcatggacgagttcagc--	Protospacer
. ************ *******.***  *.. *.*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 43004 : 50436 6 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_2 2285959 : 2293883 9 Vibrio_phage(33.33%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_006140
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006140_1 5359-5506 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage