Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013895 Mageeibacillus indolicus UPII9-5, complete sequence 1 crisprs c2c9_V-U4,csa3,DinG,DEDDh,cas14j 0 1 3 0

Results visualization

1. NC_013895
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013895_1 100989-101075 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013895_1 1.1|101020|25|NC_013895|CRISPRCasFinder 101020-101044 25 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 249745-249769 4 0.84
NC_013895_1 1.1|101020|25|NC_013895|CRISPRCasFinder 101020-101044 25 NZ_CP015032 Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence 170585-170609 5 0.8

1. spacer 1.1|101020|25|NC_013895|CRISPRCasFinder matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 4, identity: 0.84

atgcgtgggttttcgggcgtggctt	CRISPR spacer
atgcgtcgattttcgggcgtggcgc	Protospacer
****** *.************** .

2. spacer 1.1|101020|25|NC_013895|CRISPRCasFinder matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 5, identity: 0.8

atgcgtgggttttcgggcgtggctt	CRISPR spacer
gggcgtgggttttcgggcggggcag	Protospacer
. ***************** ***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 243203 : 251944 9 Geobacillus_phage(16.67%) tRNA NA
DBSCAN-SWA_2 443029 : 451168 7 Phage_TP(16.67%) tRNA,protease NA
DBSCAN-SWA_3 538610 : 554833 20 Streptococcus_phage(93.75%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage