Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012856 Ralstonia pickettii 12D chromosome 1, complete sequence 0 crisprs DEDDh,csa3,PD-DExK,DinG,WYL,cas3 0 0 7 0
NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 1 crisprs csa3 0 2 0 0
NC_012857 Ralstonia pickettii 12D chromosome 2, complete sequence 0 crisprs csa3,cas3 0 0 0 0
NC_012851 Ralstonia pickettii 12D plasmid pRp12D03, complete sequence 0 crisprs NA 0 0 1 0
NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 1 crisprs DEDDh 0 1 0 0

Results visualization

1. NC_012856
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 608828 : 621135 11 Enterobacteria_phage(22.22%) NA NA
DBSCAN-SWA_2 895328 : 903606 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 1038756 : 1088168 45 uncultured_Mediterranean_phage(20.0%) protease,transposase,integrase attL 1048117:1048132|attR 1073101:1073116
DBSCAN-SWA_4 2272748 : 2283378 14 Ralstonia_phage(81.82%) tRNA NA
DBSCAN-SWA_5 2382045 : 2417232 48 Burkholderia_phage(30.3%) terminase,head NA
DBSCAN-SWA_6 2463737 : 2472881 8 Methanothermobacter_phage(16.67%) protease NA
DBSCAN-SWA_7 2572242 : 2582510 9 unidentified_phage(14.29%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_012849
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012849_1 73917-74098 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012849_1 1.1|73935|58|NC_012849|PILER-CR 73935-73992 58 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 73935-73992 0 1.0
NC_012849_1 1.2|74011|70|NC_012849|PILER-CR 74011-74080 70 NC_012849 Ralstonia pickettii 12D plasmid pRp12D02, complete sequence 74011-74080 10 0.857

1. spacer 1.1|73935|58|NC_012849|PILER-CR matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 0, identity: 1.0

gagccaccctagagtacagcccaggtgcgacacacgagaccgtaggttggacccgctt	CRISPR spacer
gagccaccctagagtacagcccaggtgcgacacacgagaccgtaggttggacccgctt	Protospacer
**********************************************************

2. spacer 1.2|74011|70|NC_012849|PILER-CR matches to NC_012849 (Ralstonia pickettii 12D plasmid pRp12D02, complete sequence) position: , mismatch: 10, identity: 0.857

gatgaaaggtgaaaggatttggggcgcatgcgagcaggcactcccgcacaaatccatgcc	CRISPR spacer
gatgaaaggtgaaaggatttggggcgcatgcgagcaggcactcccgcacaaatccatgcc	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_012851
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10018 : 17685 12 Halomonas_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_012855
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012855_1 374229-374323 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012855_1 1.1|374252|49|NC_012855|CRISPRCasFinder 374252-374300 49 NC_012855 Ralstonia pickettii 12D plasmid pRp12D01, complete sequence 374252-374300 0 1.0

1. spacer 1.1|374252|49|NC_012855|CRISPRCasFinder matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 0, identity: 1.0

tggggcgtaagcatcagcgcggtgggtgtttgtgactgcaacgctgcgc	CRISPR spacer
tggggcgtaagcatcagcgcggtgggtgtttgtgactgcaacgctgcgc	Protospacer
*************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage