Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 1 crisprs NA 0 12 0 0
NC_012793 Geobacillus sp. WCH70, complete genome 6 crisprs Cas14u_CAS-V,cas14j,cas14k,cas8b1,cas7,cas5,cas3,cas4,cas1,cas2,cas6,csm6,csx1,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,RT,csa3,c2c4_V-U1,DEDDh,DinG,Cas14b_CAS-V-F 0 22 26 0
NC_012790 Geobacillus sp. WCH70 plasmid pWCH7002, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_012793
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_1 348817-350124 TypeIII NA
19 spacers
cas8b1,cas7,cas5,cas3,cas4,cas1,cas2,cas6,csm6,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_2 358937-361432 TypeV NA
37 spacers
cas6,cas2,cas1,cas4,cas3,cas5,cas7,cas8b1,csm6,csx1,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_3 370553-371450 TypeV NA
13 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,csx1,csm6,cas6,cas2,cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_4 372878-373162 TypeV NA
4 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,csx1,csm6,cas6,cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_5 899457-899571 TypeV-U1 NA
1 spacers
c2c4_V-U1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012793_6 2059339-2062031 Unclear I-A
41 spacers
cas2,cas4,cas3,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012793_2 2.28|360768|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT 360768-360805 38 NC_008376 Geobacillus phage GBSV1, complete genome 16369-16406 0 1.0
NC_012793_2 2.29|360836|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT 360836-360873 38 NC_029073 Geobacillus virus E3, complete genome 138448-138485 0 1.0
NC_012793_3 3.10|371180|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 371180-371216 37 AB823818 Phage phi OH2 DNA, complete genome 29899-29935 0 1.0
NC_012793_6 6.38|2061771|37|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2061771-2061807 37 NC_029073 Geobacillus virus E3, complete genome 104298-104334 0 1.0
NC_012793_1 1.2|348913|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT 348913-348950 38 NC_009552 Geobacillus virus E2, complete genome 3265-3302 1 0.974
NC_012793_1 1.18|349994|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 349994-350029 36 NC_008376 Geobacillus phage GBSV1, complete genome 18667-18702 1 0.972
NC_012793_1 1.17|349928|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 349928-349963 36 NC_009737 Bacillus virus 1, complete genome 17964-17999 2 0.944
NC_012793_1 1.18|349994|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 349994-350029 36 NC_009737 Bacillus virus 1, complete genome 18991-19026 2 0.944
NC_012793_2 2.30|360904|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 360904-360939 36 NC_009737 Bacillus virus 1, complete genome 17393-17428 2 0.944
NC_012793_4 4.7|373109|25|NC_012793|CRT 373109-373133 25 MN693025 Marine virus AFVG_117M63, complete genome 5892-5916 4 0.84
NC_012793_6 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT 2059368-2059395 28 NZ_CP033074 Buttiauxella sp. 3AFRM03 plasmid pBTX_120, complete sequence 98015-98042 5 0.821
NC_012793_6 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT 2059368-2059395 28 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 1212102-1212129 5 0.821
NC_012793_6 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT 2059368-2059395 28 KC292024 Halovirus HHTV-2, complete genome 48048-48075 6 0.786
NC_012793_3 3.14|371381|32|NC_012793|CRT 371381-371412 32 NZ_CP031836 Lactobacillus amylolyticus strain L5 plasmid p1, complete sequence 194958-194989 7 0.781
NC_012793_3 3.14|371381|32|NC_012793|CRT 371381-371412 32 NZ_CP020458 Lactobacillus amylolyticus strain L6 plasmid pL6-1, complete sequence 208157-208188 7 0.781
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024317 Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp72, complete sequence 14663-14697 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024206 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp72, complete sequence 14668-14702 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024352 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp72, complete sequence 14679-14713 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP021873 Borrelia miyamotoi strain CA17-2241 plasmid lp72, complete sequence 16214-16248 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024372 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp72, complete sequence 14657-14691 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024391 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp72, complete sequence 58853-58887 8 0.771
NC_012793_2 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359638-359672 35 NZ_CP024334 Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp72, complete sequence 57712-57746 8 0.771
NC_012793_2 2.12|359703|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359703-359738 36 MT028491 Ochrobactrum phage vB_OspM_OC, complete genome 96455-96490 8 0.778
NC_012793_3 3.8|371046|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT 371046-371081 36 AB823818 Phage phi OH2 DNA, complete genome 23968-24003 8 0.778
NC_012793_3 3.14|371381|32|NC_012793|CRT 371381-371412 32 NZ_KY303941 Enterococcus faecalis strain 3 plasmid pGTC3, complete sequence 132391-132422 8 0.75
NC_012793_3 3.14|371381|32|NC_012793|CRT 371381-371412 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 2351-2382 8 0.75
NC_012793_2 2.27|360701|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 360701-360737 37 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 172944-172980 9 0.757
NC_012793_3 3.14|371381|32|NC_012793|CRT 371381-371412 32 NZ_CP040339 Bacillus luti strain FJ plasmid unnamed3, complete sequence 14428-14459 9 0.719
NC_012793_6 6.17|2060410|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060410-2060444 35 HQ332137 Prochlorococcus phage P-SSP3 genomic sequence 29293-29327 9 0.743
NC_012793_6 6.17|2060410|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060410-2060444 35 GU071107 Cyanophage P-SSP2, complete genome 23334-23368 9 0.743
NC_012793_6 6.31|2061318|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2061318-2061352 35 MN694024 Marine virus AFVG_250M601, complete genome 14521-14555 9 0.743
NC_012793_2 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359238-359274 37 NZ_KT897276 Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence 39274-39310 10 0.73
NC_012793_2 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359238-359274 37 NZ_KT897280 Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence 38185-38221 10 0.73
NC_012793_2 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359238-359274 37 NZ_KT897277 Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence 39274-39310 10 0.73
NC_012793_2 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359238-359274 37 NZ_KT897278 Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence 38185-38221 10 0.73
NC_012793_2 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 359238-359274 37 NZ_KT897279 Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence 38185-38221 10 0.73
NC_012793_3 3.10|371180|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT 371180-371216 37 KY271401 Klebsiella phage 1 LV-2017, complete genome 16923-16959 10 0.73
NC_012793_6 6.5|2059622|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2059622-2059656 35 NZ_CP039728 Bacillus sp. S3 plasmid unnamed, complete sequence 229532-229566 10 0.714
NC_012793_3 3.3|370714|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT 370714-370751 38 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 562553-562590 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP053971 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence 128149-128186 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP013278 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence 182714-182751 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NC_018509 Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence 176598-176635 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP039724 Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence 186008-186045 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP051859 Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence 53817-53854 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP009347 Bacillus thuringiensis HD1002 plasmid 3, complete sequence 92573-92610 11 0.711
NC_012793_6 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2060209-2060246 38 NZ_CP045025 Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence 182714-182751 11 0.711
NC_012793_6 6.28|2061127|34|NC_012793|CRISPRCasFinder,CRT,PILER-CR 2061127-2061160 34 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 212987-213020 11 0.676

1. spacer 2.28|360768|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_008376 (Geobacillus phage GBSV1, complete genome) position: , mismatch: 0, identity: 1.0

ttatagcgaagcgaccaataatggatatgatggggaac	CRISPR spacer
ttatagcgaagcgaccaataatggatatgatggggaac	Protospacer
**************************************

2. spacer 2.29|360836|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_029073 (Geobacillus virus E3, complete genome) position: , mismatch: 0, identity: 1.0

ccatcatcaggtagcaagttgccatcttgctacgacaa	CRISPR spacer
ccatcatcaggtagcaagttgccatcttgctacgacaa	Protospacer
**************************************

3. spacer 3.10|371180|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to AB823818 (Phage phi OH2 DNA, complete genome) position: , mismatch: 0, identity: 1.0

atattgaaatcattaccgtagtgactgcaaagggcga	CRISPR spacer
atattgaaatcattaccgtagtgactgcaaagggcga	Protospacer
*************************************

4. spacer 6.38|2061771|37|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NC_029073 (Geobacillus virus E3, complete genome) position: , mismatch: 0, identity: 1.0

cgggcagacggggtgagcttggtcaatatcctgtcaa	CRISPR spacer
cgggcagacggggtgagcttggtcaatatcctgtcaa	Protospacer
*************************************

5. spacer 1.2|348913|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_009552 (Geobacillus virus E2, complete genome) position: , mismatch: 1, identity: 0.974

tctgtccgggatgtactgaagcatacggttgacggcgc	CRISPR spacer
tctgtccgggatgtgctgaagcatacggttgacggcgc	Protospacer
**************.***********************

6. spacer 1.18|349994|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_008376 (Geobacillus phage GBSV1, complete genome) position: , mismatch: 1, identity: 0.972

ttccccgcctgccgcgaccgcttggccccactcttg	CRISPR spacer
ttccccgcctgccgcgaccgctcggccccactcttg	Protospacer
**********************.*************

7. spacer 1.17|349928|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_009737 (Bacillus virus 1, complete genome) position: , mismatch: 2, identity: 0.944

tatttgttgagctgcgcttctgtgtactcgatttcc	CRISPR spacer
tatttgttcaactgcgcttctgtgtactcgatttcc	Protospacer
******** *.*************************

8. spacer 1.18|349994|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_009737 (Bacillus virus 1, complete genome) position: , mismatch: 2, identity: 0.944

ttccccgcctgccgcgaccgcttggccccactcttg	CRISPR spacer
ttcgccgcctgccgcgaccgcttggccccactcctg	Protospacer
*** *****************************.**

9. spacer 2.30|360904|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NC_009737 (Bacillus virus 1, complete genome) position: , mismatch: 2, identity: 0.944

gattggatgctggcaataattaaatcctgtaactcc	CRISPR spacer
gattggatgctggcaataatcaaatcctgcaactcc	Protospacer
********************.********.******

10. spacer 4.7|373109|25|NC_012793|CRT matches to MN693025 (Marine virus AFVG_117M63, complete genome) position: , mismatch: 4, identity: 0.84

ccaagctaaaaaaggttctattatt	CRISPR spacer
aaaaggtaaaaaaggttctattgtt	Protospacer
  *** ****************.**

11. spacer 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT matches to NZ_CP033074 (Buttiauxella sp. 3AFRM03 plasmid pBTX_120, complete sequence) position: , mismatch: 5, identity: 0.821

ctgtttggcttgttctttctcgtatatg	CRISPR spacer
gtgttgggctttttctttctcgtataca	Protospacer
 **** ***** **************..

12. spacer 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 5, identity: 0.821

ctgtttggcttgttctttctcgtatatg-	CRISPR spacer
ttgtttggcttgttctttgtcgc-tacgt	Protospacer
.***************** ***. **.* 

13. spacer 6.1|2059368|28|NC_012793|CRISPRCasFinder,CRT matches to KC292024 (Halovirus HHTV-2, complete genome) position: , mismatch: 6, identity: 0.786

ctgtttggcttgttctttctcgtatatg	CRISPR spacer
ctgtttggcctgttccttctcgtccagc	Protospacer
*********.*****.******* .*  

14. spacer 3.14|371381|32|NC_012793|CRT matches to NZ_CP031836 (Lactobacillus amylolyticus strain L5 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

tttcatccgaatatttcagaaaatctttaatt	CRISPR spacer
ctagattggaataattgagaaaatctttaatt	Protospacer
.*  **. ***** ** ***************

15. spacer 3.14|371381|32|NC_012793|CRT matches to NZ_CP020458 (Lactobacillus amylolyticus strain L6 plasmid pL6-1, complete sequence) position: , mismatch: 7, identity: 0.781

tttcatccgaatatttcagaaaatctttaatt	CRISPR spacer
ctagattggaataattgagaaaatctttaatt	Protospacer
.*  **. ***** ** ***************

16. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024317 (Borrelia miyamotoi strain Yekat-6 plasmid pYkt6-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

17. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024206 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

18. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024352 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

19. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021873 (Borrelia miyamotoi strain CA17-2241 plasmid lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

20. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024372 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

21. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024391 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

22. spacer 2.11|359638|35|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024334 (Borrelia miyamotoi strain Yekat-1 plasmid pYkt1-lp72, complete sequence) position: , mismatch: 8, identity: 0.771

attgaaatataaaacataaatattgacttaaacaa	CRISPR spacer
aattaaatataaaatagaaatattgacttggacgt	Protospacer
* * **********.* ************..**. 

23. spacer 2.12|359703|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to MT028491 (Ochrobactrum phage vB_OspM_OC, complete genome) position: , mismatch: 8, identity: 0.778

ctctttttgttcttgaagctgtttcacatatgctag	CRISPR spacer
gtgatgctgttcatgaagctgttacacatatgctgg	Protospacer
 *  * .***** ********** **********.*

24. spacer 3.8|371046|36|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to AB823818 (Phage phi OH2 DNA, complete genome) position: , mismatch: 8, identity: 0.778

taagtataacacgggaggggtccgagtgggaaaacg	CRISPR spacer
atattataccacgggaggggtccgagtggtaaagta	Protospacer
  * **** ******************** ***...

25. spacer 3.14|371381|32|NC_012793|CRT matches to NZ_KY303941 (Enterococcus faecalis strain 3 plasmid pGTC3, complete sequence) position: , mismatch: 8, identity: 0.75

-tttcatccgaatatttcagaaaatctttaatt	CRISPR spacer
gcgataacc-aatatttcagaaaatcttgattt	Protospacer
 .  .* ** ****************** * **

26. spacer 3.14|371381|32|NC_012793|CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tttcatccgaatatttcagaaaatctttaatt--	CRISPR spacer
gttcatccgaatattccagagaatgtc--atcgg	Protospacer
 **************.****.*** *.  **.  

27. spacer 2.27|360701|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 9, identity: 0.757

cagcgacttttacaaggttaacgcccttcaaatactc	CRISPR spacer
tagcgacttttacaaggtcaacgaccttgtatttatg	Protospacer
.*****************.**** ****  * *  * 

28. spacer 3.14|371381|32|NC_012793|CRT matches to NZ_CP040339 (Bacillus luti strain FJ plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tttcatccgaatatttcagaaaatctttaatt	CRISPR spacer
tagctaaaaaatatttcaaaaaatgtttaatt	Protospacer
*  *    .*********.***** *******

29. spacer 6.17|2060410|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to HQ332137 (Prochlorococcus phage P-SSP3 genomic sequence) position: , mismatch: 9, identity: 0.743

taatttacccatctaccaatctctttatcaaaaat	CRISPR spacer
tgccatacccatctaccactatctttatcaagttt	Protospacer
*. . ************* * **********.  *

30. spacer 6.17|2060410|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to GU071107 (Cyanophage P-SSP2, complete genome) position: , mismatch: 9, identity: 0.743

taatttacccatctaccaatctctttatcaaaaat	CRISPR spacer
tgccatacccatctaccactatctttatcaagttt	Protospacer
*. . ************* * **********.  *

31. spacer 6.31|2061318|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to MN694024 (Marine virus AFVG_250M601, complete genome) position: , mismatch: 9, identity: 0.743

tttcatgaagaaatgaaacggctaaagaatttgaa	CRISPR spacer
tacctggaagaaataaaactgctaaagaattgcat	Protospacer
* .*  ********.**** ***********  * 

32. spacer 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT897276 (Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence) position: , mismatch: 10, identity: 0.73

aggtgcatcaaatgaaacagtatttttgtcagattcg	CRISPR spacer
taatatatcaaatgaaacagtatatttatcagaagca	Protospacer
 ..*..***************** ***.*****  *.

33. spacer 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT897280 (Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence) position: , mismatch: 10, identity: 0.73

aggtgcatcaaatgaaacagtatttttgtcagattcg	CRISPR spacer
caatatatcaaatgaaacagtatatttatcagaagca	Protospacer
 ..*..***************** ***.*****  *.

34. spacer 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT897277 (Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence) position: , mismatch: 10, identity: 0.73

aggtgcatcaaatgaaacagtatttttgtcagattcg	CRISPR spacer
taatatatcaaatgaaacagtatatttatcagaagca	Protospacer
 ..*..***************** ***.*****  *.

35. spacer 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT897278 (Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence) position: , mismatch: 10, identity: 0.73

aggtgcatcaaatgaaacagtatttttgtcagattcg	CRISPR spacer
caatatatcaaatgaaacagtatatttatcagaagca	Protospacer
 ..*..***************** ***.*****  *.

36. spacer 2.5|359238|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KT897279 (Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence) position: , mismatch: 10, identity: 0.73

aggtgcatcaaatgaaacagtatttttgtcagattcg	CRISPR spacer
caatatatcaaatgaaacagtatatttatcagaagca	Protospacer
 ..*..***************** ***.*****  *.

37. spacer 3.10|371180|37|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 10, identity: 0.73

atattgaaatcattaccgtagtgactgcaaagggcga	CRISPR spacer
ttcgagaaatcactaccgtagtgactgaaaaacccgc	Protospacer
 *   *******.************** ***.  ** 

38. spacer 6.5|2059622|35|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039728 (Bacillus sp. S3 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714

gtttttatgttggttattgtttattgtttttatat	CRISPR spacer
ctttttaagttggttattggttattgggtcagtta	Protospacer
 ****** *********** ******  *. .*  

39. spacer 3.3|370714|38|NC_012793|PILER-CR,CRISPRCasFinder,CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.711

atgcgtaggcgttgacgatggattccttgattgtgtcc	CRISPR spacer
tttcgtaggcgttgacgatggtttccgtgaaactaaag	Protospacer
 * ****************** **** ***   *.   

40. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

41. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

42. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

43. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

44. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

45. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

46. spacer 6.14|2060209|38|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.711

gggatgttctcattgcaaaagattttgatgataaccaa	CRISPR spacer
tccctattctctttgcaaaagattttgaagataaattt	Protospacer
    *.***** **************** ***** .  

47. spacer 6.28|2061127|34|NC_012793|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 11, identity: 0.676

acttttcacggctatctcgtgtccgacgcttcgc	CRISPR spacer
gatgccttgggctatctcgtgtccgacggctcgg	Protospacer
. * ...  ******************* .*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155157 : 298879 109 Synechococcus_phage(11.43%) transposase,tRNA,protease NA
DBSCAN-SWA_2 310184 : 382835 52 Bacteriophage(25.0%) transposase,tRNA,holin NA
DBSCAN-SWA_3 488519 : 553032 54 Planktothrix_phage(28.57%) transposase,protease NA
DBSCAN-SWA_4 577638 : 643780 59 Streptococcus_phage(33.33%) transposase,integrase attL 582159:582176|attR 625353:625370
DBSCAN-SWA_5 867569 : 924252 47 Geobacillus_virus(22.22%) transposase NA
DBSCAN-SWA_6 930386 : 975575 38 Yersinia_phage(16.67%) transposase,protease NA
DBSCAN-SWA_7 1292586 : 1352274 53 Bacillus_phage(27.27%) transposase NA
DBSCAN-SWA_8 1372096 : 1443789 49 Bacteriophage(28.57%) transposase,tRNA NA
DBSCAN-SWA_9 1457380 : 1528593 49 Clostridium_phage(33.33%) transposase NA
DBSCAN-SWA_10 1556167 : 1628332 56 Bacillus_virus(40.0%) transposase NA
DBSCAN-SWA_11 1650810 : 1716764 54 Virus_Rctr71(23.08%) transposase,integrase attL 1686623:1686637|attR 1719803:1719817
DBSCAN-SWA_12 1732448 : 1780821 36 Paenibacillus_phage(30.0%) transposase NA
DBSCAN-SWA_13 1808323 : 1932685 109 Virus_Rctr71(16.0%) transposase NA
DBSCAN-SWA_14 1961128 : 2021788 49 Bacillus_phage(40.0%) transposase,coat NA
DBSCAN-SWA_15 2056273 : 2190527 98 Streptococcus_phage(20.0%) tRNA,transposase,integrase,protease,coat attL 2107177:2107206|attR 2166105:2166134
DBSCAN-SWA_16 2208305 : 2219344 13 Pandoravirus(25.0%) NA NA
DBSCAN-SWA_17 2238854 : 2249407 12 Enterococcus_phage(50.0%) transposase,protease,coat NA
DBSCAN-SWA_18 2283615 : 2295244 14 Staphylococcus_phage(44.44%) transposase NA
DBSCAN-SWA_19 2548401 : 2605244 56 uncultured_Mediterranean_phage(14.29%) transposase,tRNA,protease,coat NA
DBSCAN-SWA_20 2799000 : 2899178 95 Staphylococcus_phage(33.33%) tRNA,holin,transposase,integrase,portal attL 2857312:2857371|attR 2873249:2873312
DBSCAN-SWA_21 2915416 : 2970866 58 Paenibacillus_phage(15.38%) transposase,coat NA
DBSCAN-SWA_22 3019496 : 3082673 58 Streptococcus_phage(27.27%) transposase NA
DBSCAN-SWA_23 3089850 : 3159238 51 Bacillus_phage(28.57%) transposase,integrase,protease attL 3103100:3103138|attR 3130152:3130190
DBSCAN-SWA_24 3164664 : 3229365 55 Virus_Rctr71(12.5%) transposase NA
DBSCAN-SWA_25 3238802 : 3295187 47 Tupanvirus(25.0%) transposase NA
DBSCAN-SWA_26 3345989 : 3453368 95 Bacillus_phage(17.39%) transposase,tRNA,protease,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_012794
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012794_1 26787-27218 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012794_1 1.1|26817|36|NC_012794|CRISPRCasFinder 26817-26852 36 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26817-26852 0 1.0
NC_012794_1 1.2|26883|39|NC_012794|CRISPRCasFinder 26883-26921 39 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26883-26921 0 1.0
NC_012794_1 1.3|26952|35|NC_012794|CRISPRCasFinder,PILER-CR 26952-26986 35 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26952-26986 0 1.0
NC_012794_1 1.4|27017|38|NC_012794|CRISPRCasFinder,PILER-CR 27017-27054 38 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27017-27054 0 1.0
NC_012794_1 1.5|27085|35|NC_012794|CRISPRCasFinder,PILER-CR 27085-27119 35 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27085-27119 0 1.0
NC_012794_1 1.6|27150|39|NC_012794|CRISPRCasFinder,PILER-CR 27150-27188 39 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27150-27188 0 1.0
NC_012794_1 1.7|26817|41|NC_012794|CRT 26817-26857 41 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26817-26857 0 1.0
NC_012794_1 1.8|26883|44|NC_012794|CRT 26883-26926 44 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26883-26926 0 1.0
NC_012794_1 1.9|26952|40|NC_012794|CRT 26952-26991 40 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 26952-26991 0 1.0
NC_012794_1 1.10|27017|43|NC_012794|CRT 27017-27059 43 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27017-27059 0 1.0
NC_012794_1 1.11|27085|40|NC_012794|CRT 27085-27124 40 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27085-27124 0 1.0
NC_012794_1 1.12|27150|44|NC_012794|CRT 27150-27193 44 NC_012794 Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence 27150-27193 0 1.0
NC_012794_1 1.1|26817|36|NC_012794|CRISPRCasFinder 26817-26852 36 MN334766 Serratia phage PCH45, complete genome 1916-1951 7 0.806

1. spacer 1.1|26817|36|NC_012794|CRISPRCasFinder matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tgctcttcaaaagctccatacgacgtttacggggct	CRISPR spacer
tgctcttcaaaagctccatacgacgtttacggggct	Protospacer
************************************

2. spacer 1.2|26883|39|NC_012794|CRISPRCasFinder matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

acaacaaggtgattatgcaaaggcgcaaggagattatgc	CRISPR spacer
acaacaaggtgattatgcaaaggcgcaaggagattatgc	Protospacer
***************************************

3. spacer 1.3|26952|35|NC_012794|CRISPRCasFinder,PILER-CR matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tgctcgtgtggatgaaattcacggcacatcaagtg	CRISPR spacer
tgctcgtgtggatgaaattcacggcacatcaagtg	Protospacer
***********************************

4. spacer 1.4|27017|38|NC_012794|CRISPRCasFinder,PILER-CR matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

gaaagcgttccattcttaataggacaaattttaaaata	CRISPR spacer
gaaagcgttccattcttaataggacaaattttaaaata	Protospacer
**************************************

5. spacer 1.5|27085|35|NC_012794|CRISPRCasFinder,PILER-CR matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

gagtctgaacgtctagaagggcttatctatagcat	CRISPR spacer
gagtctgaacgtctagaagggcttatctatagcat	Protospacer
***********************************

6. spacer 1.6|27150|39|NC_012794|CRISPRCasFinder,PILER-CR matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tctgctggatagatttcttttgctcttcctcccagcgat	CRISPR spacer
tctgctggatagatttcttttgctcttcctcccagcgat	Protospacer
***************************************

7. spacer 1.7|26817|41|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tgctcttcaaaagctccatacgacgtttacggggctgtttt	CRISPR spacer
tgctcttcaaaagctccatacgacgtttacggggctgtttt	Protospacer
*****************************************

8. spacer 1.8|26883|44|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

acaacaaggtgattatgcaaaggcgcaaggagattatgcgtttc	CRISPR spacer
acaacaaggtgattatgcaaaggcgcaaggagattatgcgtttc	Protospacer
********************************************

9. spacer 1.9|26952|40|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tgctcgtgtggatgaaattcacggcacatcaagtggtttc	CRISPR spacer
tgctcgtgtggatgaaattcacggcacatcaagtggtttc	Protospacer
****************************************

10. spacer 1.10|27017|43|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

gaaagcgttccattcttaataggacaaattttaaaatagtttc	CRISPR spacer
gaaagcgttccattcttaataggacaaattttaaaatagtttc	Protospacer
*******************************************

11. spacer 1.11|27085|40|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

gagtctgaacgtctagaagggcttatctatagcatgtttc	CRISPR spacer
gagtctgaacgtctagaagggcttatctatagcatgtttc	Protospacer
****************************************

12. spacer 1.12|27150|44|NC_012794|CRT matches to NC_012794 (Geobacillus sp. WCH70 plasmid pWCH7001, complete sequence) position: , mismatch: 0, identity: 1.0

tctgctggatagatttcttttgctcttcctcccagcgatgtttc	CRISPR spacer
tctgctggatagatttcttttgctcttcctcccagcgatgtttc	Protospacer
********************************************

13. spacer 1.1|26817|36|NC_012794|CRISPRCasFinder matches to MN334766 (Serratia phage PCH45, complete genome) position: , mismatch: 7, identity: 0.806

tgctc-ttcaaaagctccatacgacgtttacggggct	CRISPR spacer
-actcgttcagaagctctatacgacgtttacggattt	Protospacer
 .*** ****.******.***************. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage