Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011761 Acidithiobacillus ferrooxidans ATCC 23270, complete sequence 8 crisprs DEDDh,cas3,cas14i,DinG,csf1gr8,csf2gr7,csf3gr5,cas6f,c2c8_V-U2,Cas9_archaeal,c2c10_CAS-V-U3,csa3,PrimPol 0 5 4 0

Results visualization

1. NC_011761
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_1 934317-934408 TypeIV-A,TypeV NA
1 spacers
cas14i,DinG,csf1gr8,csf2gr7,csf3gr5,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_2 934674-934937 TypeIV-A,TypeV NA
4 spacers
cas14i,DinG,csf1gr8,csf2gr7,csf3gr5,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_3 940769-941144 TypeIV-A,TypeV NA
6 spacers
cas6f,csf3gr5,csf2gr7,csf1gr8,DinG,cas14i

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_4 941242-941384 TypeIV-A,TypeV NA
2 spacers
cas6f,csf3gr5,csf2gr7,csf1gr8,DinG,cas14i

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_5 1028928-1029108 orTypeII NA
2 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_6 1061556-1061658 TypeV-U2 NA
1 spacers
c2c8_V-U2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_7 1235306-1235384 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011761_8 1475517-1475608 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011761_2 2.3|934818|29|NC_011761|CRISPRCasFinder,CRT 934818-934846 29 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 230245-230273 4 0.862
NC_011761_2 2.2|934758|29|NC_011761|CRISPRCasFinder,CRT 934758-934786 29 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 78471-78499 5 0.828
NC_011761_1 1.1|934348|29|NC_011761|CRISPRCasFinder 934348-934376 29 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 109046-109074 6 0.793
NC_011761_1 1.1|934348|29|NC_011761|CRISPRCasFinder 934348-934376 29 MH588547 Caulobacter phage CcrSC, complete genome 111247-111275 6 0.793
NC_011761_1 1.1|934348|29|NC_011761|CRISPRCasFinder 934348-934376 29 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 234843-234871 6 0.793
NC_011761_2 2.6|934881|28|NC_011761|PILER-CR 934881-934908 28 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2178342-2178369 6 0.786
NC_011761_2 2.4|934878|29|NC_011761|CRISPRCasFinder,CRT 934878-934906 29 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2178341-2178369 7 0.759
NC_011761_1 1.1|934348|29|NC_011761|CRISPRCasFinder 934348-934376 29 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 62667-62695 8 0.724
NC_011761_1 1.1|934348|29|NC_011761|CRISPRCasFinder 934348-934376 29 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 49370-49398 8 0.724

1. spacer 2.3|934818|29|NC_011761|CRISPRCasFinder,CRT matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.862

-gcagtcagggcatctgcaacttgcgcgat	CRISPR spacer
tgca-taagagcatctgcaacttgctcgat	Protospacer
 *** * **.*************** ****

2. spacer 2.2|934758|29|NC_011761|CRISPRCasFinder,CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 5, identity: 0.828

tagctcatccccttccgggccctctgcgt	CRISPR spacer
tagctcctcccctcccgggccctccggat	Protospacer
****** ******.**********.* .*

3. spacer 1.1|934348|29|NC_011761|CRISPRCasFinder matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgatttccagcattcggtcgcccat	CRISPR spacer
ccgccgatttcctgcattcggtcgagccc	Protospacer
 *********** ***********  * .

4. spacer 1.1|934348|29|NC_011761|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 6, identity: 0.793

gcgccgatttccagcattcggtcgcccat	CRISPR spacer
atcgcgatttccaggaatcggtcgcccat	Protospacer
..  ********** * ************

5. spacer 1.1|934348|29|NC_011761|CRISPRCasFinder matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.793

gcgccgatttccagcattcggtcgcccat-	CRISPR spacer
gcgccgatttcccgcattcggt-gctggcg	Protospacer
************ ********* **. .. 

6. spacer 2.6|934881|28|NC_011761|PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 6, identity: 0.786

tgatcatcttggtagaccgcgacatatc	CRISPR spacer
tcatcatcgtggtagaccccgacatcaa	Protospacer
* ****** ********* ******   

7. spacer 2.4|934878|29|NC_011761|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.759

tgatcatcttggtagaccgcgacatatca	CRISPR spacer
tcatcatcgtggtagaccccgacatcaac	Protospacer
* ****** ********* ******    

8. spacer 1.1|934348|29|NC_011761|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.724

gcgccgatttccagcattcggtcgcccat	CRISPR spacer
gcgccgatttccagcatcccgtcctgtcc	Protospacer
*****************.* *** . . .

9. spacer 1.1|934348|29|NC_011761|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724

gcgccgatttccagcattcggtcgcccat	CRISPR spacer
cacccgatttccagcatccggtcgtcggg	Protospacer
   **************.******.* . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 265258 : 274044 11 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 441198 : 488691 40 uncultured_virus(15.38%) protease,integrase,transposase attL 441055:441086|attR 444437:444468
DBSCAN-SWA_3 996621 : 1023042 42 Wolbachia_phage(25.0%) protease,transposase,integrase attL 1005931:1005944|attR 1023923:1023936
DBSCAN-SWA_4 1535548 : 1543835 6 Paramecium_bursaria_Chlorella_virus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage