Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011899 Halothermothrix orenii H 168, complete sequence 1 crisprs csa3,DEDDh,DinG,cas3,csx20,csx1,csm6,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,cas6,cas4,cas2,cas1,cas5,cas7b,cas8b1,WYL 0 2 1 0

Results visualization

1. NC_011899
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011899_1 1621711-1623280 TypeI NA
21 spacers
cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7,csm6,csx1,csx20,cas6,cas4,cas2,cas1,cas3,cas5,cas7b,cas8b1,WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011899_1 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1623067-1623100 34 NC_011836 Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence 24093-24126 7 0.794
NC_011899_1 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1623067-1623100 34 NC_009466 Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence 22476-22509 7 0.794
NC_011899_1 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1623067-1623100 34 MN693190 Marine virus AFVG_25M52, complete genome 32061-32094 7 0.794
NC_011899_1 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1623067-1623100 34 MN693247 Marine virus AFVG_25M51, complete genome 31844-31877 7 0.794
NC_011899_1 1.17|1622919|36|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1622919-1622954 36 NZ_CP025850 Escherichia coli strain 600468 plasmid p600468_158, complete sequence 69399-69434 8 0.778
NC_011899_1 1.17|1622919|36|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1622919-1622954 36 NZ_CP024249 Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence 147720-147755 8 0.778
NC_011899_1 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT 1623067-1623100 34 NC_019428 Anabaena sp. 90 plasmid pANA01, complete sequence 75885-75918 10 0.706

1. spacer 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to NC_011836 (Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence) position: , mismatch: 7, identity: 0.794

taatattaactttccaattatcaggtttgcttaa	CRISPR spacer
tgacttgacatttccaattatcgggtttgcttaa	Protospacer
*.*. * *  ************.***********

2. spacer 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to NC_009466 (Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence) position: , mismatch: 7, identity: 0.794

taatattaactttccaattatcaggtttgcttaa	CRISPR spacer
tgacttgacatttccaattatcgggtttgcttaa	Protospacer
*.*. * *  ************.***********

3. spacer 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to MN693190 (Marine virus AFVG_25M52, complete genome) position: , mismatch: 7, identity: 0.794

taatattaactttccaattatcaggtttgcttaa	CRISPR spacer
gattaaagaatttccaattatcaggtttgattaa	Protospacer
 * **  .* ******************* ****

4. spacer 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to MN693247 (Marine virus AFVG_25M51, complete genome) position: , mismatch: 7, identity: 0.794

taatattaactttccaattatcaggtttgcttaa	CRISPR spacer
gattaaagaatttccaattatcaggtttgattaa	Protospacer
 * **  .* ******************* ****

5. spacer 1.17|1622919|36|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025850 (Escherichia coli strain 600468 plasmid p600468_158, complete sequence) position: , mismatch: 8, identity: 0.778

ctaaaaccggcagaagaaaaagaaaatataaaaata	CRISPR spacer
tttaaatatacagaagaaaaagaaataataaaaata	Protospacer
.* ***.  .***************  *********

6. spacer 1.17|1622919|36|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.778

ctaaaaccggcagaagaaaaagaaaatataaaaata	CRISPR spacer
tttaaatatacagaagaaaaagaaataataaaaata	Protospacer
.* ***.  .***************  *********

7. spacer 1.19|1623067|34|NC_011899|PILER-CR,CRISPRCasFinder,CRT matches to NC_019428 (Anabaena sp. 90 plasmid pANA01, complete sequence) position: , mismatch: 10, identity: 0.706

taatattaactttccaattatcaggtttgcttaa	CRISPR spacer
ggaaataaactttccaattatcaggattcttctc	Protospacer
 .* ** ****************** ** .*.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2407008 : 2415563 8 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage