Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010557 Burkholderia ambifaria MC40-6 chromosome 3, complete sequence 1 crisprs cas14j,c2c9_V-U4,csa3,Cas14u_CAS-V 0 1 0 0
NC_010552 Burkholderia ambifaria MC40-6 chromosome 2, complete sequence 0 crisprs RT,cas3,csa3,c2c9_V-U4,Cas14u_CAS-V,DinG,DEDDh 0 0 0 0
NC_010551 Burkholderia ambifaria MC40-6 chromosome 1, complete sequence 6 crisprs cas3,DEDDh,csa3,c2c9_V-U4,Cas14u_CAS-V,DinG 0 1 3 0
NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 0 crisprs RT,PD-DExK 0 0 3 0

Results visualization

1. NC_010557
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010557_1 176537-176613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010557_1 1.1|176560|31|NC_010557|CRISPRCasFinder 176560-176590 31 NZ_CP034087 Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence 48052-48082 7 0.774
NC_010557_1 1.1|176560|31|NC_010557|CRISPRCasFinder 176560-176590 31 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 856894-856924 8 0.742
NC_010557_1 1.1|176560|31|NC_010557|CRISPRCasFinder 176560-176590 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 512907-512937 9 0.71
NC_010557_1 1.1|176560|31|NC_010557|CRISPRCasFinder 176560-176590 31 CP016641 Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence 2693-2723 9 0.71

1. spacer 1.1|176560|31|NC_010557|CRISPRCasFinder matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 7, identity: 0.774

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggtcacagcggcggtcgcgggcggacag	Protospacer
********** ************. .  **.

2. spacer 1.1|176560|31|NC_010557|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggtcgcgtcggcggtcgcggcgacgtcg	Protospacer
*******.*.************* .** . .

3. spacer 1.1|176560|31|NC_010557|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcggccacgtcggcggtcgcggagctgtcg	Protospacer
*****.***.**************. . . .

4. spacer 1.1|176560|31|NC_010557|CRISPRCasFinder matches to CP016641 (Mycobacterium sp. djl-10 plasmid djl-10_1, complete sequence) position: , mismatch: 9, identity: 0.71

ggcggtcacatcggcggtcgcggaaacccaa	CRISPR spacer
ggcagtcacagcggcggtcgcggcggcgttg	Protospacer
***.****** ************ ..* . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_010551
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_1 595251-595345 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_2 1842393-1842503 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_3 2391838-2391909 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_4 2483005-2483114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_5 3095071-3095142 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010551_6 3201282-3201388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 448865-448890 2 0.923
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 445484-445509 4 0.846
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 445533-445558 4 0.846
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 445582-445607 4 0.846
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NC_047925 Lactobacillus phage Nyseid, complete genome 76513-76538 6 0.769
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 KU052488 Lactobacillus phage SA-C12, complete genome 32574-32599 6 0.769
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 NC_047897 Lactobacillus phage Lenus, complete genome 73873-73898 6 0.769
NC_010551_5 5.1|3095094|26|NC_010551|CRISPRCasFinder 3095094-3095119 26 MT162468 Synechococcus phage S-H25, complete genome 16021-16046 6 0.769

1. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.923

agagttagtgctttagcacttacccg	CRISPR spacer
agcgttagtgctttagcacttacacg	Protospacer
** ******************** **

2. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

agagttagtgctttagcacttacccg	CRISPR spacer
agagttagcgctttagcgcttactca	Protospacer
********.********.*****.*.

3. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

agagttagtgctttagcacttacccg	CRISPR spacer
agagttagcgctttagcgcttactca	Protospacer
********.********.*****.*.

4. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

agagttagtgctttagcacttacccg	CRISPR spacer
agagttagcgctttagcgcttactct	Protospacer
********.********.*****.* 

5. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NC_047925 (Lactobacillus phage Nyseid, complete genome) position: , mismatch: 6, identity: 0.769

agagttagtgctttagcacttacccg	CRISPR spacer
tcagttagtgctttagcacttatata	Protospacer
  ********************. ..

6. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to KU052488 (Lactobacillus phage SA-C12, complete genome) position: , mismatch: 6, identity: 0.769

agagttagtgctttagcacttacccg	CRISPR spacer
tcagttagtgctttagcacttatata	Protospacer
  ********************. ..

7. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to NC_047897 (Lactobacillus phage Lenus, complete genome) position: , mismatch: 6, identity: 0.769

agagttagtgctttagcacttacccg	CRISPR spacer
tcagttagtgctttagcacttatata	Protospacer
  ********************. ..

8. spacer 5.1|3095094|26|NC_010551|CRISPRCasFinder matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 6, identity: 0.769

agagttagtgctttagcacttacccg	CRISPR spacer
gcagttagtgcttttgcacttacaat	Protospacer
. ************ ********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 411014 : 456572 32 uncultured_Caudovirales_phage(40.0%) transposase,protease,plate NA
DBSCAN-SWA_2 846952 : 854133 7 Enterobacteria_phage(33.33%) NA NA
DBSCAN-SWA_3 3321962 : 3356153 23 Erwinia_phage(33.33%) protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_010553
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 45190 : 88792 32 Ralstonia_phage(33.33%) transposase,integrase attL 81016:81032|attR 91395:91411
DBSCAN-SWA_2 100887 : 159879 41 Hokovirus(33.33%) transposase NA
DBSCAN-SWA_3 192402 : 242668 59 Enterobacteria_phage(25.0%) plate,integrase attL 196984:196999|attR 253461:253476
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage