Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010556 Exiguobacterium sibiricum 255-15, complete sequence 1 crisprs cas3,cas5,cas8c,cas7,cas4,cas1,cas2,cas14j,csa3,DinG,Cas14u_CAS-V,WYL,DEDDh 0 2 2 0
NC_010549 Exiguobacterium sibiricum 255-15 plasmid pEXIG01, complete sequence 0 crisprs NA 0 0 0 0
NC_010550 Exiguobacterium sibiricum 255-15 plasmid pEXIG02, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_010556
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010556_1 173195-174213 TypeI I-C
15 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010556_1 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT 173953-173986 34 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 67147-67180 8 0.765
NC_010556_1 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT 173953-173986 34 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 67187-67220 8 0.765
NC_010556_1 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT 173953-173986 34 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 67147-67180 8 0.765
NC_010556_1 1.14|174084|33|NC_010556|PILER-CR,CRISPRCasFinder,CRT 174084-174116 33 MG592433 Vibrio phage 1.052.A._10N.286.46.C3, partial genome 18259-18291 9 0.727

1. spacer 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 8, identity: 0.765

ccaacgctcctgctgcaactcacccgtgataccg	CRISPR spacer
ccgccgctcctgctccaactcacccgcgaatggg	Protospacer
**. ********** ***********.**    *

2. spacer 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 8, identity: 0.765

ccaacgctcctgctgcaactcacccgtgataccg	CRISPR spacer
ccgccgctcctgctccaactcacccgcgaatggg	Protospacer
**. ********** ***********.**    *

3. spacer 1.12|173953|34|NC_010556|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 8, identity: 0.765

ccaacgctcctgctgcaactcacccgtgataccg	CRISPR spacer
ccgccgctcctgctccaactcacccgcgaatggg	Protospacer
**. ********** ***********.**    *

4. spacer 1.14|174084|33|NC_010556|PILER-CR,CRISPRCasFinder,CRT matches to MG592433 (Vibrio phage 1.052.A._10N.286.46.C3, partial genome) position: , mismatch: 9, identity: 0.727

gcgcacgacgggacaaaaggaaatgtcatggtc	CRISPR spacer
tatcacgacgggacaaaacgcaatgtcagcggg	Protospacer
   *************** * *******  *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1641850 : 1648805 10 Lactococcus_phage(57.14%) NA NA
DBSCAN-SWA_2 2379679 : 2387527 8 Moraxella_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage