Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010518 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD05, complete sequence 0 crisprs DEDDh 0 0 0 0
NC_010505 Methylobacterium radiotolerans JCM 2831, complete sequence 7 crisprs cas3,csa3,RT,WYL,DEDDh,PD-DExK 1 2 5 0
NC_010507 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD08, complete sequence 0 crisprs NA 0 0 0 0
NC_010514 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD03, complete sequence 0 crisprs NA 0 0 0 0
NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 0 crisprs NA 0 0 1 0
NC_010502 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence 0 crisprs NA 0 0 0 0
NC_010517 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD04, complete sequence 0 crisprs NA 0 0 1 0
NC_010504 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD07, complete sequence 0 crisprs NA 0 0 0 0
NC_010509 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence 1 crisprs NA 0 1 0 0

Results visualization

1. NC_010510
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 305281 : 417404 83 Bacillus_phage(21.05%) bacteriocin,integrase,transposase attL 305249:305308|attR 420300:420315
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_010505
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_1 1129334-1129673 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_2 3768881-3768972 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_3 3832375-3832561 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_4 3968559-3968659 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_5 4081057-4081150 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_6 4131965-4132059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010505_7 4946288-4946388 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_010505_1 1.1|1129353|20|NC_010505|CRT 1129353-1129372 20 NC_010505.1 491718-491737 2 0.9
NC_010505_1 1.1|1129353|20|NC_010505|CRT 1129353-1129372 20 NC_010505.1 1129326-1129345 2 0.9

1. spacer 1.1|1129353|20|NC_010505|CRT matches to position: 491718-491737, mismatch: 2, identity: 0.9

ttccacggtggcggtttcgg	CRISPR spacer
ttccacggcggcggcttcgg	Protospacer
********.*****.*****

2. spacer 1.1|1129353|20|NC_010505|CRT matches to position: 1129326-1129345, mismatch: 2, identity: 0.9

ttccacggtggcggtttcgg	CRISPR spacer
ttccacggcggcggcttcgg	Protospacer
********.*****.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010505_1 1.1|1129353|20|NC_010505|CRT 1129353-1129372 20 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 213938-213957 1 0.95
NC_010505_3 3.1|3832431|24|NC_010505|PILER-CR 3832431-3832454 24 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 335150-335173 3 0.875
NC_010505_3 3.1|3832431|24|NC_010505|PILER-CR 3832431-3832454 24 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 146966-146989 3 0.875
NC_010505_3 3.1|3832431|24|NC_010505|PILER-CR 3832431-3832454 24 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 464741-464764 4 0.833
NC_010505_3 3.1|3832431|24|NC_010505|PILER-CR 3832431-3832454 24 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 804824-804847 4 0.833
NC_010505_3 3.1|3832431|24|NC_010505|PILER-CR 3832431-3832454 24 MK962640 Achromobacter phage vB_AxyP_19-32_Axy23, complete genome 33854-33877 5 0.792

1. spacer 1.1|1129353|20|NC_010505|CRT matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 1, identity: 0.95

ttccacggtggcggtttcgg	CRISPR spacer
ttccacggtggcggtttcgt	Protospacer
******************* 

2. spacer 3.1|3832431|24|NC_010505|PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 3, identity: 0.875

cctgagcaaggccggcgtgcagca	CRISPR spacer
gctgagcaaggcgggcgtgcagcc	Protospacer
 *********** ********** 

3. spacer 3.1|3832431|24|NC_010505|PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

cctgagcaaggccggcgtgcagca	CRISPR spacer
ccccggcaaggccggcgtgcagca	Protospacer
**. .*******************

4. spacer 3.1|3832431|24|NC_010505|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.833

cctgagcaaggccggcgtgcagca	CRISPR spacer
gctgagcgaggccggcgtgcaggg	Protospacer
 ******.************** .

5. spacer 3.1|3832431|24|NC_010505|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833

cctgagcaaggccggcgtgcagca	CRISPR spacer
gctgagcgaggccggcgtgcaggg	Protospacer
 ******.************** .

6. spacer 3.1|3832431|24|NC_010505|PILER-CR matches to MK962640 (Achromobacter phage vB_AxyP_19-32_Axy23, complete genome) position: , mismatch: 5, identity: 0.792

cctgagcaaggccggcgtgcagca	CRISPR spacer
gggcagcaaggccggcgtgcagct	Protospacer
    ******************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1061249 : 1071420 11 Burkholderia_phage(33.33%) NA NA
DBSCAN-SWA_2 1571624 : 1580651 8 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 5258303 : 5294307 32 Streptococcus_phage(12.5%) head,tail,protease,portal,capsid NA
DBSCAN-SWA_4 5457465 : 5516375 60 Bacillus_virus(20.0%) transposase,tRNA,tail,protease,integrase attL 5481805:5481821|attR 5518933:5518949
DBSCAN-SWA_5 6048892 : 6056770 12 Pseudomonas_phage(16.67%) integrase attL 6050734:6050749|attR 6065719:6065734
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_010517
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19318 : 28989 9 Mycobacterium_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_010509
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010509_1 40921-41013 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010509_1 1.1|40945|45|NC_010509|CRISPRCasFinder 40945-40989 45 NC_010509 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence 40945-40989 0 1.0

1. spacer 1.1|40945|45|NC_010509|CRISPRCasFinder matches to NC_010509 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD02, complete sequence) position: , mismatch: 0, identity: 1.0

ctgattgccgggcggcgttttttcgtcatgacgaaattttccggt	CRISPR spacer
ctgattgccgggcggcgttttttcgtcatgacgaaattttccggt	Protospacer
*********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage