Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012587 Sinorhizobium fredii NGR234, complete sequence 2 crisprs csa3,WYL,cas3,DEDDh 0 6 5 0
NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 0 crisprs PrimPol,casR,csa3,RT 0 0 4 0
NC_000914 Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. NC_012587
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012587_1 1777110-1777704 Orphan NA
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012587_2 2000486-2000570 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 70160-70185 3 0.885
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 39106-39131 3 0.885
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 83545-83570 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 468201-468226 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2346743-2346768 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 JN106170 Uncultured bacterium plasmid pAKD25, complete sequence 62370-62395 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 81533-81558 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 JN106175 Uncultured bacterium plasmid pAKD34, complete sequence 54499-54524 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 JN106167 Uncultured bacterium plasmid pAKD16, complete sequence 64423-64448 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 51146-51171 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 JX194160 Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence 10202-10227 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 80472-80497 4 0.846
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 295430-295455 4 0.846
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 582219-582244 4 0.846
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 295430-295455 4 0.846
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 582219-582244 4 0.846
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 295430-295455 4 0.846
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 582219-582244 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MG099948 Mycobacterium phage Philonius, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MH926055 Mycobacterium phage Chewbacca, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MT723932 Mycobacterium phage Schnauzer, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 KU935726 Mycobacterium phage Xerxes, complete genome 20424-20449 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 KU935730 Mycobacterium phage Pipsqueaks, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MH316570 Mycobacterium phage Silvafighter, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MK524518 Mycobacterium phage Smurph, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MK977707 Mycobacterium phage LilSpotty, complete genome 21395-21420 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MK524515 Mycobacterium phage Parmesanjohn, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MH697585 Mycobacterium phage Gex, complete genome 20423-20448 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 KM588359 Mycobacterium phage Carcharodon, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MH697576 Mycobacterium phage Aggie, complete genome 20428-20453 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MH697593 Mycobacterium phage Tapioca, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 JN256079 Mycobacterium phage Charlie, complete genome 20427-20452 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 32224-32249 4 0.846
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 NZ_CP044991 Deinococcus sp. AJ005 plasmid p115k, complete sequence 105970-105995 4 0.846
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 293952-293977 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 MG869615 Polaromonas sp. E10S plasmid pE10SP1, complete sequence 5939-5964 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP019037 Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence 32140-32165 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 139046-139071 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 198129-198154 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 756071-756096 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1952565-1952590 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 225440-225465 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 252799-252824 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 LC208019 Aeropyrum globular virus 1 genomic DNA, complete genome 4241-4266 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 399137-399162 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 48799-48824 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 17729-17754 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 107161-107186 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1426106-1426131 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NC_015146 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence 68609-68634 5 0.808
NC_012587_1 1.4|1777261|26|NC_012587|CRT 1777261-1777286 26 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 7084-7109 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 399137-399162 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 48799-48824 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 17729-17754 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 107161-107186 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1426106-1426131 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NC_015146 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence 68609-68634 5 0.808
NC_012587_1 1.6|1777351|26|NC_012587|CRT 1777351-1777376 26 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 7084-7109 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP042332 Bosea sp. F3-2 plasmid pB32-1, complete sequence 399137-399162 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP018225 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence 48799-48824 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP023450 Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence 17729-17754 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP010956 Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence 107161-107186 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1426106-1426131 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NC_015146 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence 68609-68634 5 0.808
NC_012587_1 1.8|1777441|26|NC_012587|CRT 1777441-1777466 26 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 7084-7109 5 0.808
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 MN234196 Gordonia phage CloverMinnie, complete genome 775-800 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MG099948 Mycobacterium phage Philonius, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MH926055 Mycobacterium phage Chewbacca, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MT723932 Mycobacterium phage Schnauzer, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 KU935726 Mycobacterium phage Xerxes, complete genome 20424-20449 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 KU935730 Mycobacterium phage Pipsqueaks, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MH316570 Mycobacterium phage Silvafighter, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MK524518 Mycobacterium phage Smurph, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MK977707 Mycobacterium phage LilSpotty, complete genome 21395-21420 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MK524515 Mycobacterium phage Parmesanjohn, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MH697585 Mycobacterium phage Gex, complete genome 20423-20448 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 KM588359 Mycobacterium phage Carcharodon, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MH697576 Mycobacterium phage Aggie, complete genome 20428-20453 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MH697593 Mycobacterium phage Tapioca, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 JN256079 Mycobacterium phage Charlie, complete genome 20427-20452 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 207363-207388 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 44594-44619 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NZ_CP031754 Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence 32224-32249 5 0.808
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 635159-635184 5 0.808
NC_012587_1 1.2|1777171|26|NC_012587|CRT 1777171-1777196 26 NZ_CP011298 Rhodococcus erythropolis strain BG43 plasmid pRSLBG43, complete sequence 3478-3503 6 0.769
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 335756-335781 6 0.769
NC_012587_1 1.10|1777528|26|NC_012587|CRT 1777528-1777553 26 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 353761-353786 6 0.769
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 166486-166511 6 0.769
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 MN234196 Gordonia phage CloverMinnie, complete genome 775-800 6 0.769
NC_012587_1 1.12|1777615|26|NC_012587|CRT 1777615-1777640 26 NZ_CP044991 Deinococcus sp. AJ005 plasmid p115k, complete sequence 105970-105995 7 0.731

1. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 3, identity: 0.885

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gttgcgccctattcggcggcgggctg	Protospacer
*  ******* ***************

2. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.885

ggagcgccctcttcggcggcgggctg	CRISPR spacer
tgaccgccctcttcggcggcgggcag	Protospacer
 ** ******************** *

3. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
tttgcgccctattcggcggcgggctg	Protospacer
   ******* ***************

4. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
tttgcgccctattcggcggcgggctg	Protospacer
   ******* ***************

5. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg--	CRISPR spacer
ggagcggcctcttcggcggc--gccggt	Protospacer
****** *************  **.*  

6. spacer 1.2|1777171|26|NC_012587|CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

7. spacer 1.2|1777171|26|NC_012587|CRT matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

8. spacer 1.2|1777171|26|NC_012587|CRT matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

9. spacer 1.2|1777171|26|NC_012587|CRT matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

10. spacer 1.2|1777171|26|NC_012587|CRT matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgtcctgttcggcggcgggctg	Protospacer
* .***.*** ***************

11. spacer 1.2|1777171|26|NC_012587|CRT matches to JX194160 (Uncultured bacterium plasmid pM02_c6 clone c6, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

12. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgccctcttcggcggcgggctg	CRISPR spacer
gcggcgcgctcttcgccggcgggctg	Protospacer
* .**** ******* **********

13. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
tgggccgcttctccggccgccggcag	Protospacer
 **** ******.*********** *

14. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggcgcagcttcttcggccgcaggatt	Protospacer
** ***************** ** * 

15. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
tgggccgcttctccggccgccggcag	Protospacer
 **** ******.*********** *

16. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggcgcagcttcttcggccgcaggatt	Protospacer
** ***************** ** * 

17. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
tgggccgcttctccggccgccggcag	Protospacer
 **** ******.*********** *

18. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.846

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggcgcagcttcttcggccgcaggatt	Protospacer
** ***************** ** * 

19. spacer 1.10|1777528|26|NC_012587|CRT matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

20. spacer 1.10|1777528|26|NC_012587|CRT matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

21. spacer 1.10|1777528|26|NC_012587|CRT matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

22. spacer 1.10|1777528|26|NC_012587|CRT matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

23. spacer 1.10|1777528|26|NC_012587|CRT matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

24. spacer 1.10|1777528|26|NC_012587|CRT matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

25. spacer 1.10|1777528|26|NC_012587|CRT matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

26. spacer 1.10|1777528|26|NC_012587|CRT matches to MK977707 (Mycobacterium phage LilSpotty, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

27. spacer 1.10|1777528|26|NC_012587|CRT matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

28. spacer 1.10|1777528|26|NC_012587|CRT matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

29. spacer 1.10|1777528|26|NC_012587|CRT matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

30. spacer 1.10|1777528|26|NC_012587|CRT matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

31. spacer 1.10|1777528|26|NC_012587|CRT matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

32. spacer 1.10|1777528|26|NC_012587|CRT matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************* .

33. spacer 1.10|1777528|26|NC_012587|CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcgggctg	CRISPR spacer
ggagagctctccccggcggcgggcgc	Protospacer
**** *******.***********  

34. spacer 1.10|1777528|26|NC_012587|CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 4, identity: 0.846

ggagcgctctcctcggcggcg--ggctg	CRISPR spacer
ccagcgctctcctcggcggcgatggc--	Protospacer
  *******************  ***  

35. spacer 1.2|1777171|26|NC_012587|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
ctggcgccctcttcggcggcgcgctt	Protospacer
  .****************** *** 

36. spacer 1.2|1777171|26|NC_012587|CRT matches to MG869615 (Polaromonas sp. E10S plasmid pE10SP1, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
acagcgccctgttcggctgcgggctc	Protospacer
. ******** ****** ******* 

37. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
acggcgccgtcatcggcggcgggctg	Protospacer
. .***** ** **************

38. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
atcgcgcccgctttggcggcgggctg	Protospacer
.  ****** ***.************

39. spacer 1.2|1777171|26|NC_012587|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
agcccgccctcttcggaggcgggctc	Protospacer
.*  ************ ******** 

40. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
actgggccctcttcgtcggcgggctg	Protospacer
.  * ********** **********

41. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
acggcgccgtcatcggcggcgggctg	Protospacer
. .***** ** **************

42. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
tttgcgccctattcggcagcgggctg	Protospacer
   ******* ******.********

43. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
agtcggcccgcttcggcggcgggctg	Protospacer
.*   **** ****************

44. spacer 1.2|1777171|26|NC_012587|CRT matches to LC208019 (Aeropyrum globular virus 1 genomic DNA, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgccctcttcggcggcgggctg	CRISPR spacer
ggtgggccctcttcggcggcggggac	Protospacer
** * ******************   

45. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggggcagcttcttcgcccgccgcgat	Protospacer
*************** ******    

46. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

47. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

48. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

49. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcggcggcttcttcggcggccggctc	Protospacer
  ***.*********** ******* 

50. spacer 1.4|1777261|26|NC_012587|CRT matches to NC_015146 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcagcagcgtcttcggccgccggccg	Protospacer
  .***** ***************.*

51. spacer 1.4|1777261|26|NC_012587|CRT matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

52. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggggcagcttcttcgcccgccgcgat	Protospacer
*************** ******    

53. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

54. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

55. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

56. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcggcggcttcttcggcggccggctc	Protospacer
  ***.*********** ******* 

57. spacer 1.6|1777351|26|NC_012587|CRT matches to NC_015146 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcagcagcgtcttcggccgccggccg	Protospacer
  .***** ***************.*

58. spacer 1.6|1777351|26|NC_012587|CRT matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

59. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
ggggcagcttcttcgcccgccgcgat	Protospacer
*************** ******    

60. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP018225 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL4, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

61. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP023450 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

62. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP010956 (Sphingobium sp. YBL2 plasmid 2pYBL2-2, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

63. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcggcggcttcttcggcggccggctc	Protospacer
  ***.*********** ******* 

64. spacer 1.8|1777441|26|NC_012587|CRT matches to NC_015146 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE301, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
tcagcagcgtcttcggccgccggccg	Protospacer
  .***** ***************.*

65. spacer 1.8|1777441|26|NC_012587|CRT matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 5, identity: 0.808

ggggcagcttcttcggccgccggctg	CRISPR spacer
cgggcggcttcttcggccgccgcgag	Protospacer
 ****.****************   *

66. spacer 1.10|1777528|26|NC_012587|CRT matches to MN234196 (Gordonia phage CloverMinnie, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggctg	CRISPR spacer
tgagcgatctcctcggcggcggtcac	Protospacer
 ***** *************** *  

67. spacer 1.12|1777615|26|NC_012587|CRT matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

68. spacer 1.12|1777615|26|NC_012587|CRT matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

69. spacer 1.12|1777615|26|NC_012587|CRT matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

70. spacer 1.12|1777615|26|NC_012587|CRT matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

71. spacer 1.12|1777615|26|NC_012587|CRT matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

72. spacer 1.12|1777615|26|NC_012587|CRT matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

73. spacer 1.12|1777615|26|NC_012587|CRT matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

74. spacer 1.12|1777615|26|NC_012587|CRT matches to MK977707 (Mycobacterium phage LilSpotty, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

75. spacer 1.12|1777615|26|NC_012587|CRT matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

76. spacer 1.12|1777615|26|NC_012587|CRT matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

77. spacer 1.12|1777615|26|NC_012587|CRT matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

78. spacer 1.12|1777615|26|NC_012587|CRT matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

79. spacer 1.12|1777615|26|NC_012587|CRT matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

80. spacer 1.12|1777615|26|NC_012587|CRT matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
cgagcgctcttctcggcggcgggcaa	Protospacer
 *********.************. .

81. spacer 1.12|1777615|26|NC_012587|CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
tgatggctctcctcggcggcgggtca	Protospacer
 **  *******************..

82. spacer 1.12|1777615|26|NC_012587|CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
tgatggctctcctcggcggcgggtca	Protospacer
 **  *******************..

83. spacer 1.12|1777615|26|NC_012587|CRT matches to NZ_CP031754 (Rhodobacter sphaeroides strain EBL0706 plasmid p.C, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
ggagagctctccccggcggcgggcgc	Protospacer
**** *******.**********.  

84. spacer 1.12|1777615|26|NC_012587|CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.808

ggagcgctctcctcggcggcgggttg	CRISPR spacer
tgatggctctcctcggcggcgggtca	Protospacer
 **  *******************..

85. spacer 1.2|1777171|26|NC_012587|CRT matches to NZ_CP011298 (Rhodococcus erythropolis strain BG43 plasmid pRSLBG43, complete sequence) position: , mismatch: 6, identity: 0.769

ggagcgccctcttcggcggcgggctg	CRISPR spacer
atgccgcccgcttcggcggcgggctt	Protospacer
. . ***** *************** 

86. spacer 1.10|1777528|26|NC_012587|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.769

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cagtcgctctcctcggcggcgcgctt	Protospacer
 .. ***************** *** 

87. spacer 1.10|1777528|26|NC_012587|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.769

ggagcgctctcctcggcggcgggctg	CRISPR spacer
cagtcgctctcctcggcggcgcgctt	Protospacer
 .. ***************** *** 

88. spacer 1.12|1777615|26|NC_012587|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.769

ggagcgctctcctcggcggcgggttg	CRISPR spacer
tcctcgctctcctcggcggcggattc	Protospacer
    ******************.** 

89. spacer 1.12|1777615|26|NC_012587|CRT matches to MN234196 (Gordonia phage CloverMinnie, complete genome) position: , mismatch: 6, identity: 0.769

ggagcgctctcctcggcggcgggttg	CRISPR spacer
tgagcgatctcctcggcggcggtcac	Protospacer
 ***** *************** .  

90. spacer 1.12|1777615|26|NC_012587|CRT matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 7, identity: 0.731

ggagcgctctcctcggcggcgggttg	CRISPR spacer
ccagcgctctcctcggcggcgatggc	Protospacer
  *******************.    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1413164 : 1427269 14 uncultured_Mediterranean_phage(81.82%) tRNA NA
DBSCAN-SWA_2 1943645 : 1954420 12 Sulfitobacter_phage(60.0%) tail NA
DBSCAN-SWA_3 2350623 : 2360311 6 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_4 2403878 : 2462158 51 Bacillus_virus(28.57%) transposase,protease,holin,tRNA NA
DBSCAN-SWA_5 3293722 : 3343587 48 Streptococcus_phage(28.57%) transposase,protease,integrase attL 3320201:3320217|attR 3352537:3352553
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_000914
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 160277 : 271800 77 Acidithiobacillus_phage(20.83%) transposase,integrase attL 212713:212772|attR 269949:272508
DBSCAN-SWA_2 373088 : 427667 42 Vibrio_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_012586
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 82919 : 139285 41 Acidithiobacillus_phage(18.18%) protease,transposase NA
DBSCAN-SWA_2 853092 : 902791 42 Leptospira_phage(40.0%) integrase,protease,transposase attL 872387:872402|attR 901840:901855
DBSCAN-SWA_3 924389 : 988569 58 Acidithiobacillus_phage(28.57%) transposase NA
DBSCAN-SWA_4 1338307 : 1402922 44 Leptospira_phage(15.38%) integrase,transposase attL 1337950:1338009|attR 1355808:1357356
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage