Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009927 Acaryochloris marina MBIC11017 plasmid pREB2, complete sequence 0 crisprs PD-DExK,csa3,cas4,cas14j,c2c9_V-U4,RT 0 0 2 0
NC_009930 Acaryochloris marina MBIC11017 plasmid pREB5, complete sequence 0 crisprs cas4,PD-DExK 0 0 1 0
NC_009928 Acaryochloris marina MBIC11017 plasmid pREB3, complete sequence 0 crisprs cas4,RT 0 0 2 0
NC_009926 Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence 0 crisprs c2c9_V-U4,c2c8_V-U2,RT,csa3 0 0 1 0
NC_009933 Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence 1 crisprs cas4 0 1 0 0
NC_009929 Acaryochloris marina MBIC11017 plasmid pREB4, complete sequence 0 crisprs cas4 0 0 1 0
NC_009932 Acaryochloris marina MBIC11017 plasmid pREB7, complete sequence 1 crisprs DEDDh 0 1 1 0
NC_009934 Acaryochloris marina MBIC11017 plasmid pREB9, complete sequence 0 crisprs NA 0 0 0 0
NC_009925 Acaryochloris marina MBIC11017, complete sequence 3 crisprs csa3,PD-DExK,DEDDh,DinG,cas3,c2c5_V-U5,RT,cas4 0 0 17 0
NC_009931 Acaryochloris marina MBIC11017 plasmid pREB6, complete sequence 0 crisprs RT,csa3,Cas9_archaeal 0 0 1 0

Results visualization

1. NC_009927
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1927 : 43740 42 Acidithiobacillus_phage(14.29%) transposase NA
DBSCAN-SWA_2 257740 : 299421 31 Escherichia_phage(16.67%) integrase,transposase attL 274658:274676|attR 306859:306877
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009928
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65982 : 108265 36 Bacillus_phage(42.86%) transposase NA
DBSCAN-SWA_2 113477 : 179790 54 Synechococcus_phage(40.0%) transposase,integrase attL 109643:109662|attR 150904:150923
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_009926
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 118964 : 282105 106 Tupanvirus(26.32%) integrase,transposase attL 114714:114729|attR 128529:128544
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_009929
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 142719 : 193805 46 uncultured_virus(25.0%) transposase,protease,integrase attL 166164:166179|attR 198611:198626
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_009930
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7388 : 56090 56 Enterobacteria_phage(25.0%) transposase,integrase attL 10508:10522|attR 36063:36077
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
6. NC_009933
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009933_1 90274-90411 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009933_1 1.1|90317|52|NC_009933|CRISPRCasFinder 90317-90368 52 NC_009933 Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence 90317-90368 0 1.0
NC_009933_1 1.1|90317|52|NC_009933|CRISPRCasFinder 90317-90368 52 NC_009932 Acaryochloris marina MBIC11017 plasmid pREB7, complete sequence 59593-59644 4 0.923

1. spacer 1.1|90317|52|NC_009933|CRISPRCasFinder matches to NC_009933 (Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence) position: , mismatch: 0, identity: 1.0

tcttttagttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	CRISPR spacer
tcttttagttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	Protospacer
****************************************************

2. spacer 1.1|90317|52|NC_009933|CRISPRCasFinder matches to NC_009932 (Acaryochloris marina MBIC11017 plasmid pREB7, complete sequence) position: , mismatch: 4, identity: 0.923

tcttttagttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	CRISPR spacer
gtctttggttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	Protospacer
 ..***.*********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
7. NC_009932
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009932_1 59551-59687 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009932_1 1.1|59594|51|NC_009932|CRISPRCasFinder 59594-59644 51 NC_009932 Acaryochloris marina MBIC11017 plasmid pREB7, complete sequence 59594-59644 0 1.0
NC_009932_1 1.1|59594|51|NC_009932|CRISPRCasFinder 59594-59644 51 NC_009933 Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence 90318-90368 3 0.941

1. spacer 1.1|59594|51|NC_009932|CRISPRCasFinder matches to NC_009932 (Acaryochloris marina MBIC11017 plasmid pREB7, complete sequence) position: , mismatch: 0, identity: 1.0

tctttggttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	CRISPR spacer
tctttggttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	Protospacer
***************************************************

2. spacer 1.1|59594|51|NC_009932|CRISPRCasFinder matches to NC_009933 (Acaryochloris marina MBIC11017 plasmid pREB8, complete sequence) position: , mismatch: 3, identity: 0.941

tctttggttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	CRISPR spacer
cttttagttttttcatcaaaggctaacggtgcagttagcctcaatcggtgt	Protospacer
..***.*********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 39347 : 114828 60 Bacillus_phage(25.0%) tail,integrase,transposase attL 87899:87916|attR 102477:102494
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
8. NC_009925
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009925_1 2028067-2028372 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009925_2 3218306-3218413 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009925_3 4815174-4815426 Unclear NA
3 spacers
c2c5_V-U5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19515 : 89213 55 Bacillus_phage(11.11%) protease,transposase,tRNA NA
DBSCAN-SWA_2 99021 : 160084 57 uncultured_virus(28.57%) transposase NA
DBSCAN-SWA_3 219733 : 271963 43 Bacillus_phage(50.0%) integrase,tail,transposase attL 222777:222791|attR 248173:248187
DBSCAN-SWA_4 374622 : 384124 7 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_5 625266 : 690736 59 Planktothrix_phage(20.0%) protease,transposase,tRNA NA
DBSCAN-SWA_6 1574945 : 1631872 46 Bacillus_phage(37.5%) protease,transposase NA
DBSCAN-SWA_7 2382217 : 2442712 49 Bathycoccus_sp._RCC1105_virus(25.0%) protease,transposase NA
DBSCAN-SWA_8 3714415 : 3758515 41 Arthrobacter_phage(28.57%) tail,transposase,tRNA NA
DBSCAN-SWA_9 3911587 : 3976536 54 Hokovirus(33.33%) protease,transposase,tRNA NA
DBSCAN-SWA_10 4216784 : 4268845 43 Acanthocystis_turfacea_Chlorella_virus(50.0%) integrase,transposase attL 4246458:4246472|attR 4273346:4273360
DBSCAN-SWA_11 5296841 : 5352032 43 Acanthamoeba_castellanii_mimivirus(16.67%) protease,transposase NA
DBSCAN-SWA_12 5672864 : 5746445 60 Paramecium_bursaria_Chlorella_virus(10.0%) protease,transposase NA
DBSCAN-SWA_13 5896003 : 5963110 60 Hokovirus(25.0%) transposase,holin NA
DBSCAN-SWA_14 6104457 : 6167930 53 Bacillus_phage(22.22%) protease,transposase NA
DBSCAN-SWA_15 6203875 : 6239002 34 Enterobacteria_phage(28.57%) integrase,transposase attL 6200029:6200043|attR 6245910:6245924
DBSCAN-SWA_16 6249470 : 6280808 31 Bacillus_phage(20.0%) integrase,transposase attL 6263505:6263564|attR 6280848:6282233
DBSCAN-SWA_17 6306377 : 6379093 53 Enterobacteria_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
9. NC_009931
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 57236 : 88967 24 Synechococcus_phage(25.0%) transposase,protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage