Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009777 Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence 2 crisprs csa3,RT 1 2 1 0
NC_009783 Vibrio campbellii ATCC BAA-1116 chromosome I, complete sequence 2 crisprs RT,DEDDh,csa3,cas3,DinG,PrimPol,csx1,WYL 0 1 20 0
NC_009784 Vibrio campbellii ATCC BAA-1116 chromosome II, complete sequence 2 crisprs RT,csa3,cas3,cas5f,cas7f,cas6f 1 5 19 1

Results visualization

1. NC_009777
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009777_1 28648-28722 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009777_2 52769-52868 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_009783.1 1502001-1502027 0 1.0
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_009783.1 2599339-2599365 0 1.0

1. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to position: 1502001-1502027, mismatch: 0, identity: 1.0

aaaccagcacctaaaaaagaatctagc	CRISPR spacer
aaaccagcacctaaaaaagaatctagc	Protospacer
***************************

2. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to position: 2599339-2599365, mismatch: 0, identity: 1.0

aaaccagcacctaaaaaagaatctagc	CRISPR spacer
aaaccagcacctaaaaaagaatctagc	Protospacer
***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_022271 Vibrio campbellii ATCC BAA-1116 plasmid unnamed, complete sequence 28116-28142 0 1.0
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_009777 Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence 28672-28698 0 1.0
NC_009777_2 2.1|52792|54|NC_009777|CRISPRCasFinder 52792-52845 54 NC_022271 Vibrio campbellii ATCC BAA-1116 plasmid unnamed, complete sequence 52236-52289 0 1.0
NC_009777_2 2.1|52792|54|NC_009777|CRISPRCasFinder 52792-52845 54 NC_009777 Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence 52792-52845 0 1.0
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 KU737346 Bacillus phage Vinny, complete genome 40975-41001 5 0.815
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_024207 Bacillus phage Evoli, complete genome 40370-40396 5 0.815
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 NC_018856 Bacillus phage Bastille, complete genome 14622-14648 5 0.815
NC_009777_1 1.1|28672|27|NC_009777|CRISPRCasFinder 28672-28698 27 MK448855 Streptococcus phage Javan150, complete genome 7605-7631 6 0.778

1. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to NC_022271 (Vibrio campbellii ATCC BAA-1116 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

aaaccagcacctaaaaaagaatctagc	CRISPR spacer
aaaccagcacctaaaaaagaatctagc	Protospacer
***************************

2. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to NC_009777 (Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence) position: , mismatch: 0, identity: 1.0

aaaccagcacctaaaaaagaatctagc	CRISPR spacer
aaaccagcacctaaaaaagaatctagc	Protospacer
***************************

3. spacer 2.1|52792|54|NC_009777|CRISPRCasFinder matches to NC_022271 (Vibrio campbellii ATCC BAA-1116 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gggggagtgggaagggcaattcaacaacatcagtggattagagctgtatatcgt	CRISPR spacer
gggggagtgggaagggcaattcaacaacatcagtggattagagctgtatatcgt	Protospacer
******************************************************

4. spacer 2.1|52792|54|NC_009777|CRISPRCasFinder matches to NC_009777 (Vibrio campbellii ATCC BAA-1116 plasmid pVIBHAR, complete sequence) position: , mismatch: 0, identity: 1.0

gggggagtgggaagggcaattcaacaacatcagtggattagagctgtatatcgt	CRISPR spacer
gggggagtgggaagggcaattcaacaacatcagtggattagagctgtatatcgt	Protospacer
******************************************************

5. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to KU737346 (Bacillus phage Vinny, complete genome) position: , mismatch: 5, identity: 0.815

aaaccagcacctaaaaaag-aatctagc	CRISPR spacer
aaaccagcacctaaaaaagcggagtag-	Protospacer
******************* ..  *** 

6. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to NC_024207 (Bacillus phage Evoli, complete genome) position: , mismatch: 5, identity: 0.815

aaaccagcacctaaaaaag-aatctagc	CRISPR spacer
aaaccagcacctaaaaaagcggagtag-	Protospacer
******************* ..  *** 

7. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to NC_018856 (Bacillus phage Bastille, complete genome) position: , mismatch: 5, identity: 0.815

aaaccagcacctaaaaaag-aatctagc	CRISPR spacer
aaaccagcacctaaaaaagcggagtag-	Protospacer
******************* ..  *** 

8. spacer 1.1|28672|27|NC_009777|CRISPRCasFinder matches to MK448855 (Streptococcus phage Javan150, complete genome) position: , mismatch: 6, identity: 0.778

aaaccagcacctaaaaaagaatctagc	CRISPR spacer
aagccagcacctaaaaaagaagcagct	Protospacer
**.****************** * . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12862 : 56994 47 Leptospira_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009784
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009784_1 1398167-1398375 Unclear NA
3 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009784_2 1605624-1605706 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NC_009784.1 1604999-1605029 1 0.968

1. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to position: 1604999-1605029, mismatch: 1, identity: 0.968

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
caccgccatccagcgagtttgacccgcgtcc	Protospacer
*******************.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009784_1 1.2|1398256|31|NC_009784|CRT 1398256-1398286 31 NZ_CP053818 Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence 78825-78855 1 0.968
NC_009784_1 1.5|1398256|32|NC_009784|CRISPRCasFinder 1398256-1398287 32 NZ_CP053818 Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence 78825-78856 1 0.969
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 49324-49354 1 0.968
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 49974-50004 1 0.968
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 50679-50709 1 0.968
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 51330-51360 1 0.968
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 48673-48703 2 0.935
NC_009784_2 2.1|1605650|31|NC_009784|CRISPRCasFinder 1605650-1605680 31 NZ_CP053542 Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence 51981-52011 2 0.935
NC_009784_1 1.1|1398196|31|NC_009784|CRT 1398196-1398226 31 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 108990-109020 5 0.839
NC_009784_1 1.4|1398196|32|NC_009784|CRISPRCasFinder 1398196-1398227 32 NZ_CP032520 Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence 108989-109020 6 0.812

1. spacer 1.2|1398256|31|NC_009784|CRT matches to NZ_CP053818 (Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence) position: , mismatch: 1, identity: 0.968

aaataggtcgtggcttgcatcctttcgttat	CRISPR spacer
aaatgggtcgtggcttgcatcctttcgttat	Protospacer
****.**************************

2. spacer 1.5|1398256|32|NC_009784|CRISPRCasFinder matches to NZ_CP053818 (Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence) position: , mismatch: 1, identity: 0.969

aaataggtcgtggcttgcatcctttcgttatc	CRISPR spacer
aaatgggtcgtggcttgcatcctttcgttatc	Protospacer
****.***************************

3. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 1, identity: 0.968

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagttcgacccgcgtcc	Protospacer
*.*****************************

4. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 1, identity: 0.968

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagttcgacccgcgtcc	Protospacer
*.*****************************

5. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 1, identity: 0.968

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagttcgacccgcgtcc	Protospacer
*.*****************************

6. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 1, identity: 0.968

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagttcgacccgcgtcc	Protospacer
*.*****************************

7. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 2, identity: 0.935

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagtttgacccgcgtcc	Protospacer
*.*****************.***********

8. spacer 2.1|1605650|31|NC_009784|CRISPRCasFinder matches to NZ_CP053542 (Vibrio europaeus strain NPI-1 plasmid pVEu, complete sequence) position: , mismatch: 2, identity: 0.935

caccgccatccagcgagttcgacccgcgtcc	CRISPR spacer
cgccgccatccagcgagtttgacccgcgtcc	Protospacer
*.*****************.***********

9. spacer 1.1|1398196|31|NC_009784|CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839

ggttgcgaccgcttgcgctcatcgcggtatg	CRISPR spacer
tatcgcgaccgcttgcgcgcatcgcgctatg	Protospacer
 .*.************** ******* ****

10. spacer 1.4|1398196|32|NC_009784|CRISPRCasFinder matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

ggttgcgaccgcttgcgctcatcgcggtatga	CRISPR spacer
tatcgcgaccgcttgcgcgcatcgcgctatgc	Protospacer
 .*.************** ******* **** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4287 : 65454 51 Escherichia_phage(36.36%) transposase,integrase attL 29886:29900|attR 66202:66216
DBSCAN-SWA_2 236085 : 321887 88 Vibrio_phage(65.85%) integrase,portal,transposase,protease,terminase,tail,head,plate,capsid attL 249509:249524|attR 272527:272542
DBSCAN-SWA_3 648821 : 720118 54 Enterobacteria_phage(22.22%) transposase NA
DBSCAN-SWA_4 731387 : 774714 36 Leptospira_phage(20.0%) transposase NA
DBSCAN-SWA_5 805447 : 871961 41 Enterobacteria_phage(38.46%) transposase NA
DBSCAN-SWA_6 898372 : 955170 46 Vibrio_phage(16.67%) transposase,protease NA
DBSCAN-SWA_7 961671 : 968454 11 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_8 990010 : 1117612 96 Leptospira_phage(33.33%) plate,transposase,protease NA
DBSCAN-SWA_9 1155983 : 1200899 31 Vibrio_phage(37.5%) transposase NA
DBSCAN-SWA_10 1212355 : 1255465 38 Enterobacteria_phage(40.0%) transposase NA
DBSCAN-SWA_11 1277181 : 1404155 86 Enterobacteria_phage(33.33%) transposase,integrase,holin attL 1368895:1368908|attR 1403467:1403480
DBSCAN-SWA_12 1442572 : 1504354 50 Enterobacteria_phage(23.08%) transposase NA
DBSCAN-SWA_13 1515391 : 1571724 42 Enterobacteria_phage(12.5%) transposase NA
DBSCAN-SWA_14 1595504 : 1645443 36 Leptospira_phage(36.36%) transposase NA
DBSCAN-SWA_15 1839405 : 1908701 58 Wolbachia_phage(18.18%) transposase,protease NA
DBSCAN-SWA_16 1914541 : 1946601 25 Leptospira_phage(50.0%) transposase,tRNA,integrase attL 1926236:1926254|attR 1955601:1955619
DBSCAN-SWA_17 1983636 : 2046858 55 Leptospira_phage(20.0%) transposase NA
DBSCAN-SWA_18 2053793 : 2090164 32 Leptospira_phage(54.55%) transposase,tRNA NA
DBSCAN-SWA_19 2125106 : 2195084 53 Klosneuvirus(25.0%) transposase,tRNA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_009784.1|WP_021018131.1|1630377_1631406_+|hypothetical-protein 1630377_1631406_+ 342 aa aa NA HTH_ARAC NA 1595504-1645443 yes
3. NC_009783
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009783_1 1693071-1693188 Orphan NA
2 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009783_2 3640883-3641124 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 103819-103865 7 0.851
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 MH791411 UNVERIFIED: Escherichia phage Ecwhy_1, complete genome 13637-13683 7 0.851
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 MH494197 Escherichia phage CMSTMSU, complete genome 196764-196810 7 0.851
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 LN997803 Escherichia coli phage phi467 15118-15164 8 0.83
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 296497-296543 9 0.809
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 KU052038 Escherichia phage SerU-LTIIb, partial genome 1162-1208 9 0.809
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 KU052038 Escherichia phage SerU-LTIIb, partial genome 3068-3114 9 0.809
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP023526 Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence 1925-1971 9 0.809
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35420-35466 9 0.809
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP054057 Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence 85809-85855 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 52070-52116 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 52076-52122 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 52081-52127 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 52080-52126 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 KY653118 Morganella phage IME1369_01, complete genome 690-736 10 0.787
NC_009783_2 2.1|3640925|47|NC_009783|PILER-CR 3640925-3640971 47 NC_049942 Escherichia phage JLK-2012, complete sequence 23522-23568 13 0.723

1. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.851

agtaggtcaccagttcgattccggtagtcggcaccat----tcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatcaagtccggt----	Protospacer
*************************************    **.  *    

2. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to MH791411 (UNVERIFIED: Escherichia phage Ecwhy_1, complete genome) position: , mismatch: 7, identity: 0.851

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcacaaatcagccgttt	Protospacer
********************************** * **  *. ** 

3. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to MH494197 (Escherichia phage CMSTMSU, complete genome) position: , mismatch: 7, identity: 0.851

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcacaaatcagccgttt	Protospacer
********************************** * **  *. ** 

4. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to LN997803 (Escherichia coli phage phi467) position: , mismatch: 8, identity: 0.83

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg-------	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcacca-------tatgcgggcat	Protospacer
************************************       * **       

5. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 9, identity: 0.809

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatatgcgggtat	Protospacer
************************************* . .   *  

6. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 9, identity: 0.809

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatatgcgggtat	Protospacer
************************************* . .   *  

7. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 9, identity: 0.809

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccatatgcgggtat	Protospacer
************************************* . .   *  

8. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.809

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccagaatgcggcca	Protospacer
************************************   * *  ...

9. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.809

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagccggcaccaatcaagtcaca	Protospacer
***************************.******** **   *. ..

10. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP054057 (Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccaaatgcggtcat	Protospacer
************************************  . .  *.  

11. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccacttacgaccct	Protospacer
************************************.*. .  ... 

12. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccacttacgaccct	Protospacer
************************************.*. .  ... 

13. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccacttacgaccct	Protospacer
************************************.*. .  ... 

14. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgattccggtagtcggcaccacttacgaccct	Protospacer
************************************.*. .  ... 

15. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to KY653118 (Morganella phage IME1369_01, complete genome) position: , mismatch: 10, identity: 0.787

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
agtaggtcaccagttcgactccggtagccggcaccatattaaacccg	Protospacer
******************.********.********* .*   ...*

16. spacer 2.1|3640925|47|NC_009783|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 13, identity: 0.723

agtaggtcaccagttcgattccggtagtcggcaccattcttcttttg	CRISPR spacer
atcaggtcgccagttcgattccggtagccggcaccatatgcgggtac	Protospacer
* .*****.******************.********* . .   *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 151182 : 190714 36 Vibrio_phage(40.0%) tRNA,transposase NA
DBSCAN-SWA_2 241273 : 309936 58 Enterobacteria_phage(18.18%) tRNA,protease,transposase NA
DBSCAN-SWA_3 455269 : 522125 50 Indivirus(25.0%) bacteriocin,transposase,integrase attL 481754:481813|attR 538320:538412
DBSCAN-SWA_4 833283 : 841715 8 Leptospira_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_5 1044692 : 1112869 56 uncultured_Mediterranean_phage(17.65%) tRNA,transposase NA
DBSCAN-SWA_6 1131920 : 1175408 34 Enterobacteria_phage(20.0%) tRNA,transposase,integrase attL 1131827:1131886|attR 1175443:1176872
DBSCAN-SWA_7 1182162 : 1188853 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 1434558 : 1486405 48 Leptospira_phage(44.44%) protease,transposase NA
DBSCAN-SWA_9 1591448 : 1657788 56 Leptospira_phage(25.0%) tRNA,protease,transposase NA
DBSCAN-SWA_10 1665609 : 1725611 50 Enterobacteria_phage(30.0%) transposase,integrase attL 1662857:1662871|attR 1720109:1720123
DBSCAN-SWA_11 1748919 : 1818516 52 uncultured_Caudovirales_phage(14.29%) tRNA,transposase NA
DBSCAN-SWA_12 1875809 : 2043000 158 Vibrio_phage(29.69%) tRNA,portal,tail,transposase,integrase,capsid,terminase,head,plate,lysis attL 1940732:1940791|attR 2040652:2041354
DBSCAN-SWA_13 2081524 : 2152935 59 Leptospira_phage(33.33%) tRNA,transposase NA
DBSCAN-SWA_14 2156634 : 2185344 22 Vibrio_phage(33.33%) transposase NA
DBSCAN-SWA_15 2303680 : 2313104 12 Vibrio_phage(91.67%) NA NA
DBSCAN-SWA_16 2332616 : 2498778 119 Leptospira_phage(24.24%) tRNA,transposase NA
DBSCAN-SWA_17 2534272 : 2598745 55 Enterobacteria_phage(18.18%) transposase NA
DBSCAN-SWA_18 2826594 : 2916023 71 Enterobacteria_phage(23.53%) protease,transposase NA
DBSCAN-SWA_19 2933980 : 3061675 104 Leptospira_phage(21.43%) tRNA,transposase,integrase attL 2980605:2980620|attR 3008266:3008345
DBSCAN-SWA_20 3557434 : 3576151 16 uncultured_Mediterranean_phage(18.18%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage