Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009508 Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence 0 crisprs RT,cas3 0 0 2 0
NC_009507 Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence 0 crisprs NA 0 0 0 0
NC_009511 Sphingomonas wittichii RW1, complete sequence 1 crisprs WYL,csa3,cas3,DEDDh,DinG 0 1 2 0

Results visualization

1. NC_009511
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009511_1 1477011-1477104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009511_1 1.1|1477041|34|NC_009511|CRISPRCasFinder 1477041-1477074 34 NC_023136 Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence 249512-249545 9 0.735

1. spacer 1.1|1477041|34|NC_009511|CRISPRCasFinder matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

caaatcgggcggacagcccccggctgtccgctag	CRISPR spacer
cgcgcagggcagacagcccctggctgtccggcag	Protospacer
*. .. ****.*********.********* .**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 46706 : 55169 11 Burkholderia_phage(16.67%) NA NA
DBSCAN-SWA_2 2414593 : 2455530 43 Stenotrophomonas_phage(28.57%) tail,protease,portal,terminase,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009508
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12708 : 27570 11 Mycobacterium_phage(25.0%) transposase NA
DBSCAN-SWA_2 95974 : 151177 44 Paenibacillus_phage(33.33%) transposase,integrase attL 106070:106085|attR 147275:147290
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage