Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008787 Campylobacter jejuni subsp. jejuni 81-176, complete sequence 0 crisprs DEDDh 0 0 1 0
NC_008790 Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence 1 crisprs NA 0 2 0 0
NC_008770 Campylobacter jejuni subsp. jejuni 81-176 plasmid pVir, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_008787
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1343638 : 1350533 7 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_008790
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008790_1 17243-17441 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008790_1 1.1|17273|43|NC_008790|CRISPRCasFinder 17273-17315 43 NZ_CP014743 Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence 74954-74996 0 1.0
NC_008790_1 1.1|17273|43|NC_008790|CRISPRCasFinder 17273-17315 43 NZ_CP028373 Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence 38423-38465 0 1.0
NC_008790_1 1.1|17273|43|NC_008790|CRISPRCasFinder 17273-17315 43 NC_006135 Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence 21203-21245 0 1.0
NC_008790_1 1.1|17273|43|NC_008790|CRISPRCasFinder 17273-17315 43 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 2835-2877 0 1.0
NC_008790_1 1.1|17273|43|NC_008790|CRISPRCasFinder 17273-17315 43 NZ_CP022471 Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence 17351-17393 0 1.0
NC_008790_1 1.2|17346|66|NC_008790|CRISPRCasFinder 17346-17411 66 NZ_CP014743 Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence 74837-74902 6 0.909
NC_008790_1 1.2|17346|66|NC_008790|CRISPRCasFinder 17346-17411 66 NZ_CP028373 Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence 38496-38561 6 0.909
NC_008790_1 1.2|17346|66|NC_008790|CRISPRCasFinder 17346-17411 66 NC_006135 Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence 21276-21341 6 0.909
NC_008790_1 1.2|17346|66|NC_008790|CRISPRCasFinder 17346-17411 66 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 2908-2973 6 0.909
NC_008790_1 1.2|17346|66|NC_008790|CRISPRCasFinder 17346-17411 66 NZ_CP022471 Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence 17424-17489 6 0.909

1. spacer 1.1|17273|43|NC_008790|CRISPRCasFinder matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 0, identity: 1.0

gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	CRISPR spacer
gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	Protospacer
*******************************************

2. spacer 1.1|17273|43|NC_008790|CRISPRCasFinder matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	CRISPR spacer
gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	Protospacer
*******************************************

3. spacer 1.1|17273|43|NC_008790|CRISPRCasFinder matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 0, identity: 1.0

gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	CRISPR spacer
gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	Protospacer
*******************************************

4. spacer 1.1|17273|43|NC_008790|CRISPRCasFinder matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 0, identity: 1.0

gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	CRISPR spacer
gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	Protospacer
*******************************************

5. spacer 1.1|17273|43|NC_008790|CRISPRCasFinder matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 0, identity: 1.0

gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	CRISPR spacer
gttcttattttccatatattcttttcgtaaaaatgtcaaaaat	Protospacer
*******************************************

6. spacer 1.2|17346|66|NC_008790|CRISPRCasFinder matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 6, identity: 0.909

taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	CRISPR spacer
taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	Protospacer
************************************************************

7. spacer 1.2|17346|66|NC_008790|CRISPRCasFinder matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.909

taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	CRISPR spacer
taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	Protospacer
************************************************************

8. spacer 1.2|17346|66|NC_008790|CRISPRCasFinder matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 6, identity: 0.909

taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	CRISPR spacer
taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	Protospacer
************************************************************

9. spacer 1.2|17346|66|NC_008790|CRISPRCasFinder matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 6, identity: 0.909

taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	CRISPR spacer
taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	Protospacer
************************************************************

10. spacer 1.2|17346|66|NC_008790|CRISPRCasFinder matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 6, identity: 0.909

taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	CRISPR spacer
taagtcaattttatttgaaaataagaggagtatttaataatttttgttgactttaatgta	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage