Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008704 Mycobacterium sp. KMS plasmid pMKMS02, complete sequence 0 crisprs csf1gr8,csf4gr11,csf2gr7,DEDDh 0 0 2 0
NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 0 crisprs csa3 0 0 1 0
NC_008705 Mycobacterium sp. KMS, complete sequence 4 crisprs cas3,csa3,casR,WYL,cas4,DEDDh,DinG 0 1 5 0

Results visualization

1. NC_008704
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 25554 : 65394 36 Mycobacterium_phage(37.5%) transposase NA
DBSCAN-SWA_2 165116 : 204779 30 Mycobacterium_phage(33.33%) transposase,protease,integrase attL 182291:182310|attR 186237:186256
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_008705
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008705_1 4088587-4088690 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008705_2 4533157-4533261 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008705_3 4642613-4642699 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008705_4 5574610-5574710 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008705_3 3.1|4642640|33|NC_008705|CRISPRCasFinder 4642640-4642672 33 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 522395-522427 8 0.758

1. spacer 3.1|4642640|33|NC_008705|CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 8, identity: 0.758

cccagcccgtcgtgccgagcgcccaacagaccg	CRISPR spacer
ccttgatggtcgtgccgagcgccaaatagacct	Protospacer
**. * . *************** **.***** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1534483 : 1600219 56 Corynebacterium_phage(15.38%) protease,transposase,integrase attL 1546473:1546532|attR 1598928:1600345
DBSCAN-SWA_2 1818999 : 1864456 46 Leptospira_phage(60.0%) transposase,integrase attL 1820019:1820034|attR 1823961:1823976
DBSCAN-SWA_3 1971703 : 1979429 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_4 3086612 : 3099846 18 Streptomyces_phage(22.22%) integrase,portal,terminase,capsid attL 3083487:3083502|attR 3098977:3098992
DBSCAN-SWA_5 4410505 : 4418691 9 Gordonia_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_008703
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 54898 : 100417 42 Mycobacterium_phage(27.27%) integrase,transposase attL 40741:40758|attR 94471:94488
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage