Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008388 Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence 1 crisprs NA 0 1 0 0
NC_008209 Roseobacter denitrificans OCh 114, complete sequence 1 crisprs cas3,csa3,DEDDh,RT,WYL 0 0 1 0
NC_008389 Roseobacter denitrificans OCh 114 plasmid pTB4, complete sequence 0 crisprs NA 0 0 0 0
NC_008386 Roseobacter denitrificans OCh 114 plasmid pTB1, complete sequence 0 crisprs WYL 0 0 0 0
NC_008387 Roseobacter denitrificans OCh 114 plasmid pTB2, complete sequence 0 crisprs NA 0 0 7 0

Results visualization

1. NC_008388
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008388_1 371-491 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP021046 Phaeobacter gallaeciensis strain P129 plasmid pP129_f, complete sequence 14991-15022 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP010722 Phaeobacter piscinae strain P18 plasmid pP18_g, complete sequence 36627-36658 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP045379 Sulfitobacter sp. THAF37 plasmid pTHAF37_g, complete sequence 12204-12235 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP010775 Phaeobacter piscinae strain P13 plasmid pP13_h, complete sequence 36627-36658 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP018079 Sulfitobacter sp. AM1-D1 plasmid unnamed3, complete sequence 9663-9694 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP014799 Salipiger profundus strain JLT2016 plasmid pTPRO3, complete sequence 17245-17276 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NC_008388 Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence 392-423 0 1.0
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP004397 Celeribacter indicus strain P73 plasmid pP73D, complete sequence 19231-19262 1 0.969
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP043623 Rhodobacteraceae bacterium SH-1 plasmid p5, complete sequence 3685-3716 6 0.812
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP029988 Sphingomonas sp. FARSPH plasmid p03, complete sequence 46466-46497 7 0.781
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP029988 Sphingomonas sp. FARSPH plasmid p03, complete sequence 46408-46439 9 0.719
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP049035 Fluviibacterium aquatile strain SC52 plasmid pSC52_7, complete sequence 7146-7177 10 0.688
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP015096 Pelagibaca abyssi strain JLT2014 plasmid pPABY8, complete sequence 29512-29543 10 0.688
NC_008388_1 1.1|396|32|NC_008388|PILER-CR 396-427 32 NZ_CP034817 Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence 14353-14384 10 0.688

1. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP021046 (Phaeobacter gallaeciensis strain P129 plasmid pP129_f, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

2. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP010722 (Phaeobacter piscinae strain P18 plasmid pP18_g, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

3. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP045379 (Sulfitobacter sp. THAF37 plasmid pTHAF37_g, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

4. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP010775 (Phaeobacter piscinae strain P13 plasmid pP13_h, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

5. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP018079 (Sulfitobacter sp. AM1-D1 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

6. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP014799 (Salipiger profundus strain JLT2016 plasmid pTPRO3, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

7. spacer 1.1|396|32|NC_008388|PILER-CR matches to NC_008388 (Roseobacter denitrificans OCh 114 plasmid pTB3, complete sequence) position: , mismatch: 0, identity: 1.0

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgcagt	Protospacer
********************************

8. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP004397 (Celeribacter indicus strain P73 plasmid pP73D, complete sequence) position: , mismatch: 1, identity: 0.969

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gagtcgacattcgtggttttagttaccgtagt	Protospacer
****************************.***

9. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP043623 (Rhodobacteraceae bacterium SH-1 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.812

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gcagcgacattcgtgtttttagttaccggtgt	Protospacer
* . *********** ************  **

10. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 7, identity: 0.781

-gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
cgcgccgg-attcggggtttcagttaccgcagc	Protospacer
 * *.**. ***** *****.***********.

11. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP029988 (Sphingomonas sp. FARSPH plasmid p03, complete sequence) position: , mismatch: 9, identity: 0.719

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
gggcgaggattcggggtttcagttaccgcagc	Protospacer
*.*. .. ***** *****.***********.

12. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP049035 (Fluviibacterium aquatile strain SC52 plasmid pSC52_7, complete sequence) position: , mismatch: 10, identity: 0.688

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
tgcctgatattcgtggttttaggtaccgcctg	Protospacer
 . ..**.************** ******   

13. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP015096 (Pelagibaca abyssi strain JLT2014 plasmid pPABY8, complete sequence) position: , mismatch: 10, identity: 0.688

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
ttacccacattcggggtttcagttaccgcccg	Protospacer
  ..* ******* *****.*********   

14. spacer 1.1|396|32|NC_008388|PILER-CR matches to NZ_CP034817 (Paracoccus sp. Arc7-R13 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

gagtcgacattcgtggttttagttaccgcagt	CRISPR spacer
ttaccgatattcgtgtttttagttacctgcat	Protospacer
  ..***.******* ***********   .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_008209
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008209_1 3108184-3108269 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2875540 : 2944772 63 Paracoccus_phage(17.65%) portal,integrase,tRNA,capsid,transposase,protease,tail,head attL 2943115:2943131|attR 2946756:2946772
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_008387
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1076 1 Roseobacter_phage(100.0%) NA NA
DBSCAN-SWA_2 13950 : 15846 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 19552 : 22928 4 Enterobacteria_phage(75.0%) NA NA
DBSCAN-SWA_4 35182 : 36895 1 Moumouvirus(100.0%) NA NA
DBSCAN-SWA_5 42759 : 47722 3 Hokovirus(50.0%) NA NA
DBSCAN-SWA_6 50937 : 57590 5 Tupanvirus(33.33%) NA NA
DBSCAN-SWA_7 65437 : 67375 1 Pseudomonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage