Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007791 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA02, complete sequence 0 crisprs NA 0 0 0 0
NC_007790 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA01, complete sequence 0 crisprs NA 0 0 0 0
NC_007793 Staphylococcus aureus subsp. aureus USA300_FPR3757, complete sequence 9 crisprs cas3,DEDDh,DinG,csa3,WYL 8 4 9 0
NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_007793
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_1 433556-433656 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_2 672074-672166 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_3 834527-834612 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_4 877738-877819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_5 940549-940831 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_6 1074222-1074309 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_7 2029506-2029584 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_8 2264761-2264911 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007793_9 2388923-2389116 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_007793_4 4.1|877762|34|NC_007793|CRISPRCasFinder 877762-877795 34 NC_007793.1 1366723-1366756 0 1.0
NC_007793_4 4.1|877762|34|NC_007793|CRISPRCasFinder 877762-877795 34 NC_007793.1 1455915-1455948 0 1.0
NC_007793_9 9.2|2389002|36|NC_007793|CRT 2389002-2389037 36 NC_007793.1 1158497-1158532 0 1.0
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NC_007793.1 797494-797519 1 0.962
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NC_007793.1 2830235-2830260 1 0.962
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NC_007793.1 2830291-2830316 1 0.962
NC_007793_5 5.1|940579|26|NC_007793|CRT 940579-940604 26 NC_007793.1 940523-940548 1 0.962
NC_007793_5 5.3|940693|26|NC_007793|CRT 940693-940718 26 NC_007793.1 834613-834638 1 0.962
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 834593-834625 1 0.97
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 1158553-1158585 1 0.97
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 1366678-1366710 1 0.97
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 1694551-1694583 1 0.97
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 2664885-2664917 1 0.97
NC_007793_9 9.2|2389002|36|NC_007793|CRT 2389002-2389037 36 NC_007793.1 1872844-1872879 1 0.972
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NC_007793.1 797550-797575 2 0.923
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NC_007793.1 940523-940548 2 0.923
NC_007793_5 5.1|940579|26|NC_007793|CRT 940579-940604 26 NC_007793.1 797494-797519 2 0.923
NC_007793_5 5.1|940579|26|NC_007793|CRT 940579-940604 26 NC_007793.1 2830235-2830260 2 0.923
NC_007793_5 5.1|940579|26|NC_007793|CRT 940579-940604 26 NC_007793.1 2830291-2830316 2 0.923
NC_007793_5 5.3|940693|26|NC_007793|CRT 940693-940718 26 NC_007793.1 394889-394914 2 0.923
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_007793.1 1455961-1455993 2 0.939
NC_007793_9 9.1|2388946|33|NC_007793|CRT 2388946-2388978 33 NC_007793.1 834593-834625 2 0.939
NC_007793_9 9.1|2388946|33|NC_007793|CRT 2388946-2388978 33 NC_007793.1 1158553-1158585 2 0.939
NC_007793_9 9.1|2388946|33|NC_007793|CRT 2388946-2388978 33 NC_007793.1 1366678-1366710 2 0.939
NC_007793_9 9.1|2388946|33|NC_007793|CRT 2388946-2388978 33 NC_007793.1 1455961-1455993 2 0.939
NC_007793_9 9.1|2388946|33|NC_007793|CRT 2388946-2388978 33 NC_007793.1 2664885-2664917 2 0.939
NC_007793_9 9.2|2389002|36|NC_007793|CRT 2389002-2389037 36 NC_007793.1 1694490-1694525 2 0.944
NC_007793_9 9.2|2389002|36|NC_007793|CRT 2389002-2389037 36 NC_007793.1 2040391-2040426 2 0.944
NC_007793_9 9.3|2389061|33|NC_007793|CRT 2389061-2389093 33 NC_007793.1 834593-834625 2 0.939
NC_007793_9 9.3|2389061|33|NC_007793|CRT 2389061-2389093 33 NC_007793.1 1158553-1158585 2 0.939
NC_007793_9 9.3|2389061|33|NC_007793|CRT 2389061-2389093 33 NC_007793.1 1366678-1366710 2 0.939
NC_007793_9 9.3|2389061|33|NC_007793|CRT 2389061-2389093 33 NC_007793.1 2664885-2664917 2 0.939

1. spacer 4.1|877762|34|NC_007793|CRISPRCasFinder matches to position: 1366723-1366756, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 4.1|877762|34|NC_007793|CRISPRCasFinder matches to position: 1455915-1455948, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 9.2|2389002|36|NC_007793|CRT matches to position: 1158497-1158532, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to position: 797494-797519, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ********************

5. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to position: 2830235-2830260, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
************.*************

6. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to position: 2830291-2830316, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctttgttggggccccg	Protospacer
************ *************

7. spacer 5.1|940579|26|NC_007793|CRT matches to position: 940523-940548, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

8. spacer 5.3|940693|26|NC_007793|CRT matches to position: 834613-834638, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

9. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 834593-834625, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

10. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 1158553-1158585, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

11. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 1366678-1366710, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

12. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 1694551-1694583, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

13. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 2664885-2664917, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

14. spacer 9.2|2389002|36|NC_007793|CRT matches to position: 1872844-1872879, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

15. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to position: 797550-797575, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

16. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to position: 940523-940548, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

17. spacer 5.1|940579|26|NC_007793|CRT matches to position: 797494-797519, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

18. spacer 5.1|940579|26|NC_007793|CRT matches to position: 2830235-2830260, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

19. spacer 5.1|940579|26|NC_007793|CRT matches to position: 2830291-2830316, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

20. spacer 5.3|940693|26|NC_007793|CRT matches to position: 394889-394914, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

21. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to position: 1455961-1455993, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

22. spacer 9.1|2388946|33|NC_007793|CRT matches to position: 834593-834625, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

23. spacer 9.1|2388946|33|NC_007793|CRT matches to position: 1158553-1158585, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

24. spacer 9.1|2388946|33|NC_007793|CRT matches to position: 1366678-1366710, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

25. spacer 9.1|2388946|33|NC_007793|CRT matches to position: 1455961-1455993, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

26. spacer 9.1|2388946|33|NC_007793|CRT matches to position: 2664885-2664917, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 9.2|2389002|36|NC_007793|CRT matches to position: 1694490-1694525, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

28. spacer 9.2|2389002|36|NC_007793|CRT matches to position: 2040391-2040426, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

29. spacer 9.3|2389061|33|NC_007793|CRT matches to position: 834593-834625, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

30. spacer 9.3|2389061|33|NC_007793|CRT matches to position: 1158553-1158585, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

31. spacer 9.3|2389061|33|NC_007793|CRT matches to position: 1366678-1366710, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

32. spacer 9.3|2389061|33|NC_007793|CRT matches to position: 2664885-2664917, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007793_5 5.4|940749|53|NC_007793|CRT 940749-940801 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
NC_007793_3 3.1|834557|26|NC_007793|CRISPRCasFinder 834557-834582 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
NC_007793_5 5.3|940693|26|NC_007793|CRT 940693-940718 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
NC_007793_7 7.1|2029529|33|NC_007793|CRISPRCasFinder 2029529-2029561 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 5.4|940749|53|NC_007793|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

4. spacer 3.1|834557|26|NC_007793|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

5. spacer 5.3|940693|26|NC_007793|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

6. spacer 7.1|2029529|33|NC_007793|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 766185 : 774005 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 789739 : 800708 10 uncultured_Caudovirales_phage(62.5%) NA NA
DBSCAN-SWA_3 879300 : 895129 22 Staphylococcus_phage(66.67%) terminase,capsid,integrase attL 881837:881853|attR 895793:895809
DBSCAN-SWA_4 1059446 : 1067919 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1509687 : 1596925 107 Staphylococcus_phage(84.42%) head,terminase,plate,integrase,holin,protease,capsid,tail,tRNA,portal attL 1546050:1546070|attR 1591943:1591963
DBSCAN-SWA_6 1666113 : 1674425 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_7 1743562 : 1752605 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1877907 : 1957239 76 Staphylococcus_phage(95.0%) tRNA,protease,transposase NA
DBSCAN-SWA_9 2043946 : 2142728 120 Staphylococcus_phage(89.02%) head,terminase,integrase,protease,holin,capsid,tail,tRNA,portal attL 2103913:2103930|attR 2128845:2128862
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage