Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007509 Burkholderia lata chromosome 3, complete sequence 0 crisprs WYL,csa3,c2c9_V-U4,RT 0 0 0 0
NC_007510 Burkholderia lata chromosome 1, complete sequence 2 crisprs WYL,csa3,cas3,DEDDh,DinG,PrimPol 1 1 3 0
NC_007511 Burkholderia lata chromosome 2, complete sequence 2 crisprs csa3,PD-DExK,WYL,DinG,cas3,RT 0 2 1 0

Results visualization

1. NC_007511
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007511_1 3151-3267 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007511_2 225249-225568 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007511_2 2.3|225425|31|NC_007511|CRISPRCasFinder 225425-225455 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1073398-1073428 8 0.742
NC_007511_2 2.3|225425|31|NC_007511|CRISPRCasFinder 225425-225455 31 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 871327-871357 8 0.742
NC_007511_2 2.3|225425|31|NC_007511|CRISPRCasFinder 225425-225455 31 NZ_CP022193 Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence 36974-37004 9 0.71
NC_007511_2 2.3|225425|31|NC_007511|CRISPRCasFinder 225425-225455 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 433713-433743 9 0.71
NC_007511_2 2.3|225425|31|NC_007511|CRISPRCasFinder 225425-225455 31 NZ_CP014311 Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence 174204-174234 10 0.677
NC_007511_1 1.1|3169|34|NC_007511|PILER-CR 3169-3202 34 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 312113-312146 11 0.676

1. spacer 2.3|225425|31|NC_007511|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
accgtacgcggcgccgtcgaaccgtcgcgag	Protospacer
.    .*****.* *****************

2. spacer 2.3|225425|31|NC_007511|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
gaagagcgcggtgacgtcgaacggccgcggt	Protospacer
*.. .***************** *.****. 

3. spacer 2.3|225425|31|NC_007511|CRISPRCasFinder matches to NZ_CP022193 (Yangia pacifica strain YSBP01 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
ccaaggcgcggagacgtcgaaccggcgctcc	Protospacer
  . ******* ************ ***   

4. spacer 2.3|225425|31|NC_007511|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
aaaggtgacggcgacgacgaaccgtcgcgag	Protospacer
... *  .***.**** **************

5. spacer 2.3|225425|31|NC_007511|CRISPRCasFinder matches to NZ_CP014311 (Burkholderia sp. PAMC 26561 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.677

gggtggcgcggtgacgtcgaaccgtcgcgag	CRISPR spacer
attctcggcggtgacgtcgaccggtcgcgac	Protospacer
.  .   ************* * ******* 

6. spacer 1.1|3169|34|NC_007511|PILER-CR matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

gggaaatcagggttttcctgcccggaacccgctg	CRISPR spacer
cctgtttcagggttttccggcacggaacccgtaa	Protospacer
   .  ************ ** *********. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1154712 : 1159250 8 Burkholderia_phage(50.0%) integrase attL 1145859:1145872|attR 1158863:1158876
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007510
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007510_1 864043-864269 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007510_2 3000899-3000971 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_007510_1 1.1|864066|49|NC_007510|CRT 864066-864114 49 NC_007510.1 863934-863982 0 1.0

1. spacer 1.1|864066|49|NC_007510|CRT matches to position: 863934-863982, mismatch: 0, identity: 1.0

ttcgaacccgctggcgccggtccaaggcgtcgtgaaccaagtgacgggc	CRISPR spacer
ttcgaacccgctggcgccggtccaaggcgtcgtgaaccaagtgacgggc	Protospacer
*************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007510_2 2.1|3000922|27|NC_007510|CRISPRCasFinder 3000922-3000948 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 993183-993209 5 0.815

1. spacer 2.1|3000922|27|NC_007510|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.815

aaagcgccaagggcggtcgaccgcctt	CRISPR spacer
ggagcgccatgggcggtcgatcgccat	Protospacer
..******* **********.**** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 744669 : 753761 7 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 1099634 : 1107922 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_3 2004235 : 2059218 50 Stx2-converting_phage(20.0%) transposase,integrase,protease attL 2014914:2014931|attR 2021543:2021560
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage