Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007940 Rickettsia bellii RML369-C, complete sequence 4 crisprs PD-DExK,DEDDh,cas3 1 0 1 0

Results visualization

1. NC_007940
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007940_1 75731-75826 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007940_2 360987-361240 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007940_3 686789-687043 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007940_4 1299835-1299958 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_007940_1 1.1|75758|42|NC_007940|CRISPRCasFinder 75758-75799 42 NC_007940.1 1234228-1234269 2 0.952

1. spacer 1.1|75758|42|NC_007940|CRISPRCasFinder matches to position: 1234228-1234269, mismatch: 2, identity: 0.952

gcaacaaggtagagaagaagaaaaagctattatggcaaagaa	CRISPR spacer
gcaacaaggtagagaagaagaaaaagctatcatggtaaagaa	Protospacer
******************************.****.******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 783206 : 793579 7 Catovirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage