Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_002976 Staphylococcus epidermidis RP62A, complete sequence 2 crisprs csa3,cas3,DEDDh,DinG,WYL,cas6,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas2,cas1 0 5 7 0
NC_006663 Staphylococcus epidermidis RP62A plasmid pSERP, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_002976
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002976_1 1993515-1993597 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002976_2 2517615-2517868 TypeIII NA
3 spacers
cas1,cas2,cas10,csm2gr11,csm3gr7,csm4gr5,csm5gr7,csm6,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 NC_008723 Staphylococcus phage PH15, complete genome 16869-16898 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_CP026078 Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed 26785-26814 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KU882682 Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence 20644-20673 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KT780704 Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence 59138-59167 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KT780705 Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence 29197-29226 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 46509-46538 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KU882681 Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence 37223-37252 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030382 Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030491 Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030606 Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence 1824-1853 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030388 Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence 8234-8263 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 32205-32234 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030522 Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence 7490-7519 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 52959-52988 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030554 Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 27435-27464 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030618 Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030671 Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence 39245-39274 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 8174-8203 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 8174-8203 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013320 Staphylococcus aureus plasmid SAP014A, complete sequence 14263-14292 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 19626-19655 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013343 Staphylococcus aureus plasmid SAP080A, complete sequence 34529-34558 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030556 Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence 16790-16819 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030639 Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence 19781-19810 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030677 Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence 26221-26250 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030600 Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence 4556-4585 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 25838-25867 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 8204-8233 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 11506-11535 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030429 Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence 19782-19811 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030648 Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence 19780-19809 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 32356-32385 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030407 Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence 19779-19808 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030559 Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence 29523-29552 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030678 Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence 7916-7945 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 36680-36709 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 38065-38094 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030591 Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence 31910-31939 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030453 Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence 19778-19807 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KU882683 Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence 5962-5991 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013338 Staphylococcus aureus plasmid SAP068A, complete sequence 6142-6171 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030622 Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence 23257-23286 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013339 Staphylococcus aureus plasmid SAP069A, complete sequence 26758-26787 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 22791-22820 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030538 Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence 41577-41606 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030435 Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence 6866-6895 0 1.0
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP030526 Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence 6866-6895 0 1.0
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 NC_008723 Staphylococcus phage PH15, complete genome 16870-16903 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_CP026078 Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed 26786-26819 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KU882682 Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence 20645-20678 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KU882683 Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence 5957-5990 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KT780704 Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence 59139-59172 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KT780705 Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence 29198-29231 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KT373969 Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence 46510-46543 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KU882681 Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence 37224-37257 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030382 Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030491 Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030606 Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence 1825-1858 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030388 Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence 8235-8268 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_007792 Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence 32206-32239 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030522 Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence 7491-7524 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_005054 Staphylococcus aureus plasmid pLW043, complete sequence 52960-52993 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030554 Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030614 Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence 27436-27469 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013338 Staphylococcus aureus plasmid SAP068A, complete sequence 6137-6170 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030618 Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030671 Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence 39246-39279 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_012547 Staphylococcus aureus plasmid pGO1, complete sequence 8175-8208 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030622 Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence 23252-23285 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_005024 Staphylococcus aureus plasmid pSK41, complete sequence 8175-8208 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013320 Staphylococcus aureus plasmid SAP014A, complete sequence 14264-14297 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013339 Staphylococcus aureus plasmid SAP069A, complete sequence 26753-26786 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013342 Staphylococcus aureus plasmid SAP079A, complete sequence 19627-19660 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013343 Staphylococcus aureus plasmid SAP080A, complete sequence 34530-34563 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013344 Staphylococcus aureus plasmid SAP082A, complete sequence 22786-22819 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030538 Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence 41572-41605 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030556 Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence 16791-16824 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030639 Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence 19782-19815 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030435 Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence 6861-6894 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030526 Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence 6861-6894 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030677 Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence 26222-26255 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030600 Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence 4557-4590 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_AP017321 Staphylococcus aureus strain MI plasmid pMI, complete sequence 25839-25872 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_CP026963 Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1 11507-11540 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030429 Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence 19783-19816 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030648 Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence 19781-19814 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_020535 Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence 32357-32390 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030407 Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence 19780-19813 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030559 Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence 29524-29557 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030678 Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence 7917-7950 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_CP040620 Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence 36681-36714 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_MH587578 Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence 38066-38099 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030591 Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence 31911-31944 0 1.0
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP030453 Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence 19779-19812 0 1.0
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 KY653120 Staphylococcus phage IME1348_01, complete genome 31822-31851 1 0.967
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 16168-16197 1 0.967
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 KU598975 Staphylococcus phage CNPx, complete genome 16222-16251 1 0.967
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 15766-15795 1 0.967
NC_002976_2 2.2|2517726|30|NC_002976|CRT 2517726-2517755 30 DQ831957 Staphylococcus phage CNPH82, complete genome 16222-16251 1 0.967
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 KY653120 Staphylococcus phage IME1348_01, complete genome 31823-31856 1 0.971
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 16169-16202 1 0.971
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 KU598975 Staphylococcus phage CNPx, complete genome 16223-16256 1 0.971
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 15767-15800 1 0.971
NC_002976_2 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR 2517727-2517760 34 DQ831957 Staphylococcus phage CNPH82, complete genome 16223-16256 1 0.971
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 AP012550 Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G 8205-8238 1 0.971
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NZ_KY465818 Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence 23794-23823 2 0.933
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 18505-18534 2 0.933
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_010279 Staphylococcus aureus plasmid pV030-8, complete sequence 34107-34136 2 0.933
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 25095-25124 2 0.933
NC_002976_2 2.3|2517797|30|NC_002976|CRT 2517797-2517826 30 CP013960 Staphylococcus aureus strain V605 plasmid pV605, complete sequence 1328-1357 2 0.933
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NZ_KY465818 Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence 23795-23828 2 0.941
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_013653 Staphylococcus aureus plasmid pPR9, complete sequence 18506-18539 2 0.941
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 CP013960 Staphylococcus aureus strain V605 plasmid pV605, complete sequence 1323-1356 2 0.941
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_010279 Staphylococcus aureus plasmid pV030-8, complete sequence 34108-34141 2 0.941
NC_002976_2 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR 2517798-2517831 34 NC_018967 Staphylococcus aureus plasmid p18813-P03, complete sequence 25096-25129 2 0.941
NC_002976_2 2.1|2517656|29|NC_002976|CRT 2517656-2517684 29 KU878088 Bacillus phage AR9, complete genome 111273-111301 7 0.759
NC_002976_2 2.1|2517656|29|NC_002976|CRT 2517656-2517684 29 MF360957 Bacillus virus PBS1, complete genome 21575-21603 7 0.759
NC_002976_2 2.1|2517656|29|NC_002976|CRT 2517656-2517684 29 NZ_CP009417 Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence 563600-563628 7 0.759

1. spacer 2.2|2517726|30|NC_002976|CRT matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 0, identity: 1.0

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacgtatgcaaatgacaattat	Protospacer
******************************

2. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

3. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KU882682 (Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

4. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

5. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

6. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

7. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

8. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

9. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

10. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

11. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

12. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

13. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

14. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

15. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

16. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

17. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

18. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

19. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

20. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

21. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

22. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

23. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

24. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

25. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

26. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030677 (Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

27. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

28. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

29. spacer 2.3|2517797|30|NC_002976|CRT matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

30. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

31. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

32. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

33. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

34. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

35. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

36. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030678 (Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

37. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

38. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

39. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

40. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

41. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KU882683 (Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

42. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

43. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030622 (Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

44. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

45. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

46. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

47. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

48. spacer 2.3|2517797|30|NC_002976|CRT matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatacttcggca	Protospacer
******************************

49. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 0, identity: 1.0

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacgtatgcaaatgacaattattacta	Protospacer
**********************************

50. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_CP026078 (Staphylococcus aureus strain FDAARGOS_7 plasmid unnamed) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

51. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KU882682 (Staphylococcus lugdunensis strain K93G plasmid pK93G, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

52. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KU882683 (Staphylococcus lugdunensis strain Tlug33G-4 plasmid pT33G-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

53. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KT780704 (Staphylococcus aureus subsp. aureus RN4220 plasmid pRM27, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

54. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KT780705 (Staphylococcus aureus subsp. aureus RN4220 plasmid pGO400, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

55. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KT373969 (Staphylococcus pseudintermedius strain HR547/11 plasmid pKM01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

56. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KU882681 (Staphylococcus lugdunensis strain Tlug15G-4 plasmid pT15G-1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

57. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030382 (Staphylococcus aureus strain ER03761.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

58. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030491 (Staphylococcus aureus strain ER02837.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

59. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030606 (Staphylococcus aureus strain ER02693.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

60. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030388 (Staphylococcus aureus strain ER01062.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

61. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_007792 (Staphylococcus aureus subsp. aureus USA300_FPR3757 plasmid pUSA03, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

62. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030522 (Staphylococcus aureus strain ER01564.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

63. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_005054 (Staphylococcus aureus plasmid pLW043, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

64. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030554 (Staphylococcus aureus strain PS00003.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

65. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030614 (Staphylococcus aureus strain ER01560.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

66. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013338 (Staphylococcus aureus plasmid SAP068A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

67. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030618 (Staphylococcus aureus strain ER04440.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

68. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030671 (Staphylococcus aureus strain ER00951.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

69. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_012547 (Staphylococcus aureus plasmid pGO1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

70. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030622 (Staphylococcus aureus strain ER01524.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

71. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_005024 (Staphylococcus aureus plasmid pSK41, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

72. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013320 (Staphylococcus aureus plasmid SAP014A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

73. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013339 (Staphylococcus aureus plasmid SAP069A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

74. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013342 (Staphylococcus aureus plasmid SAP079A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

75. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013343 (Staphylococcus aureus plasmid SAP080A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

76. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013344 (Staphylococcus aureus plasmid SAP082A, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

77. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030538 (Staphylococcus aureus strain ER02094.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

78. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030556 (Staphylococcus aureus strain ER03750.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

79. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030639 (Staphylococcus aureus strain ER04165.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

80. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030435 (Staphylococcus aureus strain ER00610.3 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

81. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030526 (Staphylococcus aureus strain ER02703.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

82. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030677 (Staphylococcus aureus strain ER01533.3 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

83. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030600 (Staphylococcus aureus strain ER00658.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

84. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_AP017321 (Staphylococcus aureus strain MI plasmid pMI, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

85. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_CP026963 (Staphylococcus aureus strain FDAARGOS_6 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

86. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030429 (Staphylococcus aureus strain ER03760.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

87. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030648 (Staphylococcus aureus strain ER03556.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

88. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_020535 (Staphylococcus aureus subsp. aureus ST228 plasmid pI5S5, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

89. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030407 (Staphylococcus aureus strain PS00002.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

90. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030559 (Staphylococcus aureus strain ER01457.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

91. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030678 (Staphylococcus aureus strain ER00573.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

92. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_CP040620 (Staphylococcus aureus strain J01 plasmid pJ01-01, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

93. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_MH587578 (Staphylococcus aureus strain WG1647 plasmid pWBG615, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

94. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030591 (Staphylococcus aureus strain ER02989.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

95. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP030453 (Staphylococcus aureus strain PS00001.3 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacgt	Protospacer
**********************************

96. spacer 2.2|2517726|30|NC_002976|CRT matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 1, identity: 0.967

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacatatgcaaatgacaattat	Protospacer
***********.******************

97. spacer 2.2|2517726|30|NC_002976|CRT matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 1, identity: 0.967

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacatatgcaaatgacaattat	Protospacer
***********.******************

98. spacer 2.2|2517726|30|NC_002976|CRT matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 1, identity: 0.967

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacatatgcaaatgacaattat	Protospacer
***********.******************

99. spacer 2.2|2517726|30|NC_002976|CRT matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 1, identity: 0.967

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacatatgcaaatgacaattat	Protospacer
***********.******************

100. spacer 2.2|2517726|30|NC_002976|CRT matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 1, identity: 0.967

atcgatgtaacgtatgcaaatgacaattat	CRISPR spacer
atcgatgtaacatatgcaaatgacaattat	Protospacer
***********.******************

101. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 1, identity: 0.971

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacatatgcaaatgacaattattacta	Protospacer
**********.***********************

102. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 1, identity: 0.971

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacatatgcaaatgacaattattacta	Protospacer
**********.***********************

103. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 1, identity: 0.971

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacatatgcaaatgacaattattacta	Protospacer
**********.***********************

104. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 1, identity: 0.971

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacatatgcaaatgacaattattacta	Protospacer
**********.***********************

105. spacer 2.5|2517727|34|NC_002976|CRISPRCasFinder,PILER-CR matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 1, identity: 0.971

tcgatgtaacgtatgcaaatgacaattattacta	CRISPR spacer
tcgatgtaacatatgcaaatgacaattattacta	Protospacer
**********.***********************

106. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to AP012550 (Staphylococcus aureus plasmid pN315G DNA, complete sequence, strain: N315G) position: , mismatch: 1, identity: 0.971

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatacttcggcatacga	Protospacer
********************************* 

107. spacer 2.3|2517797|30|NC_002976|CRT matches to NZ_KY465818 (Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence) position: , mismatch: 2, identity: 0.933

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatatttaggca	Protospacer
**********************.** ****

108. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 2, identity: 0.933

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatatttaggca	Protospacer
**********************.** ****

109. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_010279 (Staphylococcus aureus plasmid pV030-8, complete sequence) position: , mismatch: 2, identity: 0.933

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatatttaggca	Protospacer
**********************.** ****

110. spacer 2.3|2517797|30|NC_002976|CRT matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 2, identity: 0.933

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatatttaggca	Protospacer
**********************.** ****

111. spacer 2.3|2517797|30|NC_002976|CRT matches to CP013960 (Staphylococcus aureus strain V605 plasmid pV605, complete sequence) position: , mismatch: 2, identity: 0.933

ctttgtactgatgatttatatacttcggca	CRISPR spacer
ctttgtactgatgatttatatatttaggca	Protospacer
**********************.** ****

112. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NZ_KY465818 (Staphylococcus aureus subsp. aureus strain CC1 plasmid p140355, complete sequence) position: , mismatch: 2, identity: 0.941

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatatttaggcatacgt	Protospacer
*********************.** *********

113. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_013653 (Staphylococcus aureus plasmid pPR9, complete sequence) position: , mismatch: 2, identity: 0.941

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatatttaggcatacgt	Protospacer
*********************.** *********

114. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to CP013960 (Staphylococcus aureus strain V605 plasmid pV605, complete sequence) position: , mismatch: 2, identity: 0.941

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatatttaggcatacgt	Protospacer
*********************.** *********

115. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_010279 (Staphylococcus aureus plasmid pV030-8, complete sequence) position: , mismatch: 2, identity: 0.941

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatatttaggcatacgt	Protospacer
*********************.** *********

116. spacer 2.6|2517798|34|NC_002976|CRISPRCasFinder,PILER-CR matches to NC_018967 (Staphylococcus aureus plasmid p18813-P03, complete sequence) position: , mismatch: 2, identity: 0.941

tttgtactgatgatttatatacttcggcatacgt	CRISPR spacer
tttgtactgatgatttatatatttaggcatacgt	Protospacer
*********************.** *********

117. spacer 2.1|2517656|29|NC_002976|CRT matches to KU878088 (Bacillus phage AR9, complete genome) position: , mismatch: 7, identity: 0.759

agagaatcaagaaaaaatgtt---cacgaccg	CRISPR spacer
agagaatcaagaaaaaattttatatgtga---	Protospacer
****************** **   ...**   

118. spacer 2.1|2517656|29|NC_002976|CRT matches to MF360957 (Bacillus virus PBS1, complete genome) position: , mismatch: 7, identity: 0.759

agagaatcaagaaaaaatgtt---cacgaccg	CRISPR spacer
agagaatcaagaaaaaattttatatgtga---	Protospacer
****************** **   ...**   

119. spacer 2.1|2517656|29|NC_002976|CRT matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

agagaatcaagaaaaaatgttcacgaccg	CRISPR spacer
agacaatcaagaaaaaatgttgagacaag	Protospacer
*** ***************** * .   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 362235 : 372771 13 Staphylococcus_phage(22.22%) NA NA
DBSCAN-SWA_2 394194 : 404629 10 uncultured_Caudovirales_phage(66.67%) NA NA
DBSCAN-SWA_3 644204 : 652674 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1242019 : 1299928 55 Bacillus_virus(12.5%) transposase,protease,integrase,tRNA attL 1241586:1241602|attR 1296124:1296140
DBSCAN-SWA_5 1365620 : 1400420 26 Staphylococcus_phage(89.47%) tRNA NA
DBSCAN-SWA_6 1403751 : 1420553 16 Staphylococcus_phage(66.67%) integrase attL 1417406:1417421|attR 1422070:1422085
DBSCAN-SWA_7 1564991 : 1697887 146 Staphylococcus_phage(97.2%) integrase,transposase,terminase,tail,holin attL 1639122:1639140|attR 1699668:1699686
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_006663
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5041 : 14505 11 Streptococcus_phage(62.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage