Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_000853 Thermotoga maritima MSB8, complete sequence 8 crisprs cas14k,TnpB_regular.1,cas3,DEDDh,csa3,cas14j,WYL,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,cas2,cas1,cas4,cas5,cas7,cas8b1,csx22,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas6 0 5 5 0

Results visualization

1. NC_000853
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_1 412-3105 Orphan III-A
40 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_2 369170-369731 Orphan III-A
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_3 396568-397133 Orphan III-A
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_4 409295-410923 Orphan III-A
24 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_5 1428083-1428244 Orphan III-A
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_6 1519912-1520474 Orphan III-A
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_7 1631789-1632016 Orphan III-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000853_8 1779810-1780701 TypeIII III-A
13 spacers
cas8b1,cas7,cas5,cas3,cas4,cas1,cas2,cmr1gr7,cas10,cmr3gr5,csx22,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_000853_8 8.3|1779970|37|NC_000853|CRISPRCasFinder,CRT,PILER-CR 1779970-1780006 37 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 996115-996151 9 0.757
NC_000853_1 1.19|1640|37|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1640-1676 37 MF417888 Uncultured Caudovirales phage clone 9S_3, partial genome 37048-37084 10 0.73
NC_000853_7 7.2|1631886|34|NC_000853|CRT 1631886-1631919 34 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 294235-294268 10 0.706
NC_000853_8 8.3|1779970|37|NC_000853|CRISPRCasFinder,CRT,PILER-CR 1779970-1780006 37 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 115273-115309 10 0.73
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554775 Lactococcus phage AM11, complete genome 48564-48598 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554773 Lactococcus phage AM8, complete genome 48561-48595 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554768 Lactococcus phage AM1, complete genome 48791-48825 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554769 Lactococcus phage AM2, complete genome 48788-48822 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554770 Lactococcus phage AM3, complete genome 49165-49199 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554776 Lactococcus phage AM12, complete genome 48545-48579 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KF926093 Lactococcus phage phiL47, complete genome 52499-52533 11 0.686
NC_000853_1 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT 1244-1278 35 KY554774 Lactococcus phage AM9, complete genome 48562-48596 11 0.686
NC_000853_3 3.3|396729|37|NC_000853|PILER-CR,CRISPRCasFinder,CRT 396729-396765 37 MH271312 Microbacterium phage RobsFeet, complete genome 48027-48063 11 0.703

1. spacer 8.3|1779970|37|NC_000853|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.757

-ttgtttttggcatgctggcgctggcgctggcgggcgc	CRISPR spacer
accgcgtct-gcatggtggcgctggcgctggcgcgcgg	Protospacer
 ..*. *.* ***** ***************** *** 

2. spacer 1.19|1640|37|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to MF417888 (Uncultured Caudovirales phage clone 9S_3, partial genome) position: , mismatch: 10, identity: 0.73

ctactatcttctatatatatatttttgtttttgtttt	CRISPR spacer
agaaaacattctacatatataattttgtttttgtcct	Protospacer
  *  *. *****.******* ************..*

3. spacer 7.2|1631886|34|NC_000853|CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

agacgttcctgtcgctggtagtgtcga-atattcg	CRISPR spacer
ctacgttcttgtcgctggtggtgtcggtgcgctc-	Protospacer
  ******.**********.******. ....** 

4. spacer 8.3|1779970|37|NC_000853|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 10, identity: 0.73

ttgtttttggcatgctggcgctggcgctggcgggcgc	CRISPR spacer
cgcatcttgccatgccggcgctggcgctggcggtggt	Protospacer
.   *.*** *****.*****************  *.

5. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554775 (Lactococcus phage AM11, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

6. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554773 (Lactococcus phage AM8, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

7. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554768 (Lactococcus phage AM1, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

8. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554769 (Lactococcus phage AM2, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

9. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554770 (Lactococcus phage AM3, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

10. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554776 (Lactococcus phage AM12, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

11. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KF926093 (Lactococcus phage phiL47, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

12. spacer 1.13|1244|35|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to KY554774 (Lactococcus phage AM9, complete genome) position: , mismatch: 11, identity: 0.686

taaacttgtaaatccttttgaagacttagaacaac	CRISPR spacer
agaatttttaaatccttttgaagacttattgtcta	Protospacer
 .**.** ********************  ..   

13. spacer 3.3|396729|37|NC_000853|PILER-CR,CRISPRCasFinder,CRT matches to MH271312 (Microbacterium phage RobsFeet, complete genome) position: , mismatch: 11, identity: 0.703

tgatccagacggcattcgtcctgtactgagctggaag	CRISPR spacer
tgatccagacggcgttcggcctgtacaagggctactg	Protospacer
*************.**** ******* ..* . .  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 311054 : 318014 7 Streptococcus_phage(33.33%) NA NA
DBSCAN-SWA_2 1110700 : 1119419 8 Erysipelothrix_phage(16.67%) NA NA
DBSCAN-SWA_3 1270495 : 1288410 16 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_4 1643389 : 1651002 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_5 1798301 : 1806244 10 Staphylococcus_phage(37.5%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage