Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_000915 Helicobacter pylori 26695, complete sequence 3 crisprs cas2,cas14j,DEDDh 1 0 1 0

Results visualization

1. NC_000915
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000915_1 350470-350596 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000915_2 556173-556460 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000915_3 1166553-1166641 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_000915_2 2.1|556236|54|NC_000915|PILER-CR 556236-556289 54 NC_000915.1 555906-555959 1 0.981

1. spacer 2.1|556236|54|NC_000915|PILER-CR matches to position: 555906-555959, mismatch: 1, identity: 0.981

cattcctagctcttgatacgcagtccaaataagccttaatgcttttcttaactt	CRISPR spacer
cattcctagctcttgatacgcagtccaaataagccttaacgcttttcttaactt	Protospacer
***************************************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1018459 : 1070383 43 Helicobacter_phage(50.0%) transposase,tRNA,integrase attL 1028966:1028985|attR 1080307:1080326
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage