Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_005814 Yersinia pestis biovar Microtus str. 91001 plasmid pCRY, complete sequence 0 crisprs NA 0 0 0 0
NC_005816 Yersinia pestis biovar Microtus str. 91001 plasmid pPCP1, complete sequence 0 crisprs NA 0 0 0 0
NC_005815 Yersinia pestis biovar Microtus str. 91001 plasmid pMT1, complete sequence 0 crisprs NA 0 0 3 0
NC_005810 Yersinia pestis biovar Microtus str. 91001, complete sequence 4 crisprs csa3,DEDDh,DinG,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1 0 10 14 0
NC_005813 Yersinia pestis biovar Microtus str. 91001 plasmid pCD1, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_005815
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 72579 72 Salmonella_phage(88.06%) tail,integrase,transposase,terminase attL 66364:66381|attR 79423:79440
DBSCAN-SWA_2 78982 : 97568 23 Salmonella_phage(40.0%) transposase NA
DBSCAN-SWA_3 103817 : 105026 1 uncultured_virus(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_005810
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005810_1 1223356-1223625 Orphan I-F
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005810_2 1475549-1475670 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005810_3 2539218-2539426 TypeI-F I-F
3 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005810_4 3473543-3473655 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_005810_1 1.1|1223384|32|NC_005810|CRISPRCasFinder,CRT 1223384-1223415 32 MT374852 Yersinia phage vB_YpM_3, complete genome 12-43 0 1.0
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 2177-2205 3 0.897
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 125228-125256 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026280 Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence 95656-95684 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 103023-103051 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018675 Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence 120287-120315 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP050860 Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence 51309-51337 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052330 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence 90179-90207 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052169 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence 126459-126487 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY093014 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence 105336-105364 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY093013 Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence 131085-131113 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY270849 Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence 94975-95003 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY174332 Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence 109728-109756 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY271407 Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence 82689-82717 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP032195 Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence 73855-73883 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP032198 Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence 45511-45539 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KX839208 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence 83599-83627 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KU295133 Escherichia coli strain BK33689 plasmid pBK33689, complete sequence 106474-106502 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KU665642 Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence 104761-104789 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KX236178 Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence 60737-60765 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KJ721790 Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence 106474-106502 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KP125893 Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence 114946-114974 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KU295132 Escherichia coli strain BK34397 plasmid pBK34397, complete sequence 94778-94806 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025142 Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence 79736-79764 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024917 Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence 87153-87181 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 63085-63113 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031262 Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence 54126-54154 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026135 Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence 112243-112271 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018434 Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence 156907-156935 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052164 Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence 85132-85160 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP043049 Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3 33106-33134 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014005 Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence 40448-40476 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 130876-130904 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP048351 Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence 138681-138709 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034282 Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence 185433-185461 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP037444 Klebsiella sp. PO552 plasmid p3, complete sequence 76441-76469 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP019900 Raoultella planticola strain GODA plasmid unnamed1, complete sequence 50915-50943 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_009649 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence 172419-172447 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_009650 Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence 104116-104144 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP049601 Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence 22932-22960 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 79495-79523 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014650 Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence 110286-110314 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011977 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence 209605-209633 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN200129 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence 64906-64934 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 242150-242178 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041928 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence 193204-193232 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP010393 Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence 156225-156253 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KJ721789 Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence 58234-58262 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020523 Escherichia coli strain 190 plasmid unnamed2, complete sequence 88768-88796 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 292091-292119 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052566 Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence 125416-125444 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052364 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence 91062-91090 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 131782-131810 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_021502 Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence 144862-144890 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 4085-4113 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP008791 Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence 25116-25144 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 102856-102884 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027037 Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence 30709-30737 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_019389 Klebsiella pneumoniae plasmid pKDO1, complete sequence 70398-70426 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023332 Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence 153755-153783 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 154159-154187 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023334 Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence 152917-152945 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 HG969996 Klebsiella pneumoniae plasmid pIT-12C47, complete sequence 94831-94859 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 HG969997 Klebsiella pneumoniae plasmid pIT-01C22, complete sequence 110820-110848 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 HG969998 Klebsiella pneumoniae plasmid pIT-11C07, complete sequence 99811-99839 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020499 Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence 159715-159743 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025038 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence 16504-16532 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025039 Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence 116289-116317 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018693 Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence 28794-28822 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034777 Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence 101714-101742 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011986 Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence 106475-106503 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020855 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence 51279-51307 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 7186-7214 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020851 Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence 137661-137689 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN891683 Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence 77480-77508 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052358 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence 84331-84359 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011981 Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence 121322-121350 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011990 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence 35528-35556 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011991 Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence 61717-61745 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027054 Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII 173423-173451 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036321 Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence 120706-120734 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MT129535 Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence 22932-22960 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MG700548 Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence 7450-7478 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_FO834904 Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence 47942-47970 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018424 Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence 156907-156935 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_015154 Klebsiella pneumoniae plasmid pc15-k, complete sequence 92184-92212 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_025187 Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence 107300-107328 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029591 Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence 23407-23435 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP023840 Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence 57147-57175 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_014016 Klebsiella pneumoniae plasmid pKpQIL, complete sequence 110284-110312 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 28055-28083 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018992 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence 46242-46270 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_016966 Klebsiella pneumoniae plasmid pUUH239.2, complete sequence 156514-156542 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_025166 Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence 106475-106503 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027614 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence 64560-64588 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP009275 Klebsiella variicola strain DX120E plasmid pKV1, complete sequence 116183-116211 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025212 Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence 25787-25815 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022698 Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence 61451-61479 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021959 Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence 56481-56509 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_025131 Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence 58235-58263 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012571 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence 58856-58884 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012572 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence 85506-85534 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028993 Klebsiella pneumoniae strain AR_0142 plasmid unnamed3, complete sequence 16840-16868 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029136 Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence 187578-187606 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052553 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence 84307-84335 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014121 Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence 119524-119552 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041640 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence 149074-149102 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041642 Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence 37971-37999 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026752 Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence 168314-168342 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 77044-77072 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036193 Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence 136227-136255 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026181 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence 61450-61478 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029000 Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence 95240-95268 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP039525 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence 80792-80820 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 KY798505 Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence 43149-43177 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 KY798506 Escherichia coli plasmid pKpQIL-D2, complete sequence 105818-105846 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 KY798507 Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence 110286-110314 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP010363 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence 4404-4432 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018355 Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence 95641-95669 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021166 Klebsiella pneumoniae strain 203 plasmid p203, complete sequence 142846-142874 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031614 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence 55152-55180 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 151463-151491 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 310523-310551 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052564 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence 77711-77739 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021541 Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence 67130-67158 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022926 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence 251046-251074 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052526 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence 129859-129887 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP017851 Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence 81081-81109 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_AP019690 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence 81796-81824 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP017286 Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence 3268-3296 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 LT009688 Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence 134967-134995 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP008701 Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence 166541-166569 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP030067 Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence 91440-91468 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP009777 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence 151358-151386 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP008833 Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence 110286-110314 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP008800 Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence 185646-185674 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044038 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence 45158-45186 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP046943 Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4 26737-26765 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP006927 Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence 133556-133584 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP008930 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence 8674-8702 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 234593-234621 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_025167 Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence 91978-92006 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_022609 Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence 89754-89782 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052287 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence 187448-187476 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052288 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence 154407-154435 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP017281 Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence 77931-77959 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018999 Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence 89274-89302 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022825 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence 90107-90135 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_011281 Klebsiella variicola strain 342 plasmid pKP91, complete sequence 82879-82907 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020065 Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence 33071-33099 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020109 Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence 111915-111943 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015387 Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence 58235-58263 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020069 Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence 105110-105138 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012566 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence 58856-58884 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012567 Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence 85505-85533 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034322 Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence 122198-122226 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036443 Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence 188500-188528 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP050379 Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence 198737-198765 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035907 Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence 136234-136262 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_032103 Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence 99163-99191 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 211836-211864 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034131 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence 129123-129151 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP050155 Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence 122781-122809 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MF918373 Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence 175335-175363 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_021199 Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence 59056-59084 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022613 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence 82403-82431 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012884 Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence 116196-116224 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP028804 Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence 244738-244766 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP030343 Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence 161862-161890 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035384 Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence 133833-133861 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026148 Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence 59131-59159 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 161809-161837 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052538 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence 235676-235704 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP023916 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence 79255-79283 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018460 Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence 178699-178727 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020903 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence 182750-182778 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020904 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence 39473-39501 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP045676 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence 139069-139097 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052535 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence 145009-145037 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 110502-110530 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 59097-59125 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034137 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence 143588-143616 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034140 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence 73183-73211 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027049 Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence 152156-152184 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN823998 Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence 60723-60751 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 141147-141175 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN824002 Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence 208264-208292 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN615880 Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence 98650-98678 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014669 Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence 110499-110527 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024510 Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence 90638-90666 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP032186 Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence 36482-36510 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027152 Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence 99302-99330 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN823984 Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence 34961-34989 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN823986 Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence 35433-35461 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 232466-232494 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015824 Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence 30098-30126 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044390 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence 139501-139529 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044391 Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence 84616-84644 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044394 Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence 138482-138510 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 57982-58010 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052374 Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence 89961-89989 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP053365 Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence 319857-319885 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018365 Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence 197371-197399 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_AP018673 Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence 126431-126459 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036439 Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence 18124-18152 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_020132 Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence 156064-156092 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_024992 Klebsiella pneumoniae plasmid pKp848CTX, complete sequence 154259-154287 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011621 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence 50600-50628 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 123328-123356 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021946 Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence 53846-53874 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022917 Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence 139152-139180 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 209080-209108 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP023948 Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence 166286-166314 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 116091-116119 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041937 Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence 62984-63012 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 104221-104249 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052438 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence 58603-58631 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 HG969995 Klebsiella pneumoniae plasmid pIT-01C03, complete sequence 110289-110317 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024543 Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence 103096-103124 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 AP022358 Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence 76947-76975 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 69162-69190 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_013950 Klebsiella pneumoniae plasmid pKF3-94, complete sequence 81005-81033 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018340 Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence 33771-33799 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP045691 Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence 123064-123092 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_LR025089 Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence 58506-58534 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP054266 Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence 60734-60762 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023904 Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence 110269-110297 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023905 Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence 112694-112722 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023906 Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence 110287-110315 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 63085-63113 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044387 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence 135238-135266 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021951 Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence 19861-19889 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 154072-154100 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_023903 Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence 110287-110315 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026016 Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence 45103-45131 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025145 Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence 76664-76692 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025148 Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence 79736-79764 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_LR792630 Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I 47942-47970 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036188 Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence 170450-170478 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MK649823 Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence 74076-74104 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MK649824 Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence 119282-119310 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015383 Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence 175057-175085 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 176468-176496 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014765 Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence 103206-103234 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026588 Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence 63779-63807 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052338 Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence 88322-88350 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 168353-168381 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_LT882698 Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence 300672-300700 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MK262711 Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence 22987-23015 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MK104259 Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence 115290-115318 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MK167989 Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence 143971-143999 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MK773536 Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence 82070-82098 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP016812 Klebsiella pneumoniae strain DHQP1002001 plasmid p_incR_DHQP1002001, complete sequence 56481-56509 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MH917122 Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence 99064-99092 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MG878868 Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence 59980-60008 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_019390 Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence 194366-194394 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN657248 Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence 119073-119101 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 195419-195447 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014777 Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence 125872-125900 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MK347425 Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence 54055-54083 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MF156708 Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence 112711-112739 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 185477-185505 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence 84897-84925 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY271404 Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence 222491-222519 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 137103-137131 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MG288683 Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence 105848-105876 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MF788069 Raoultella ornithinolytica strain 23141 plasmid p23141-1, complete sequence 54573-54601 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MF788070 Raoultella ornithinolytica strain 23141 plasmid p23141-2, complete sequence 90611-90639 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 LR134219 Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3 9371-9399 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 97808-97836 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP033755 Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence 71590-71618 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022923 Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence 157652-157680 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034407 Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence 69826-69854 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN661404 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence 79589-79617 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 LK391770 Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67 36004-36032 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026048 Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence 79952-79980 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 192334-192362 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052168 Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence 156609-156637 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY454639 Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence 79650-79678 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY270850 Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence 18934-18962 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KY271403 Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence 28862-28890 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 116005-116033 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KX636095 Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence 247114-247142 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029740 Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence 92351-92379 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KP008371 Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence 85534-85562 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_KT203286 Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence 72282-72310 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_020087 Klebsiella pneumoniae plasmid pK1HV, complete sequence 74595-74623 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021752 Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence 28518-28546 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP044529 Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence 43826-43854 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022125 Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence 147870-147898 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP017386 Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence 31281-31309 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018441 Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence 107519-107547 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP040123 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence 192596-192624 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029588 Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence 128673-128701 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP037744 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence 57308-57336 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052408 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence 88801-88829 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 180051-180079 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035216 Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence 36488-36516 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 143686-143714 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_AP018754 Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence 42182-42210 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024193 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence 87953-87981 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052401 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence 148650-148678 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN543580 Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence 62351-62379 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026276 Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence 108776-108804 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 179116-179144 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN543573 Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence 156167-156195 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025468 Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence 37234-37262 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028954 Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence 22614-22642 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP033627 Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence 126953-126981 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036302 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence 119400-119428 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036328 Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence 92322-92350 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN586817 Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence 28814-28842 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_LR130542 Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2 154491-154519 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 149341-149369 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 179007-179035 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015135 Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence 80109-80137 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020842 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence 122133-122161 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020843 Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence 66771-66799 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031811 Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence 119120-119148 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP032832 Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence 342945-342973 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN891675 Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence 45941-45969 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041949 Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence 90388-90416 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020838 Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence 90863-90891 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028784 Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence 122534-122562 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035776 Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence 248912-248940 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 209792-209820 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052218 Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence 118316-118344 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_019155 Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence 28864-28892 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 30931-30959 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN310379 Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence 157253-157281 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 9723-9751 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031735 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence 147115-147143 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028177 Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence 75988-76016 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP047686 Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence 45263-45291 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018815 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence 121925-121953 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP037966 Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence 120252-120280 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052148 Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence 136777-136805 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041084 Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence 98651-98679 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026271 Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence 53434-53462 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022442 Klebsiella sp. LY plasmid unnamed1, complete sequence 21509-21537 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036337 Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence 33533-33561 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052415 Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence 127497-127525 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041094 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence 110017-110045 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041100 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence 135062-135090 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021834 Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence 208232-208260 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027613 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence 109860-109888 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027616 Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence 122111-122139 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024876 Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence 20991-21019 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022692 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence 146683-146711 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022693 Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence 57401-57429 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP047683 Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence 45271-45299 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022920 Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence 28856-28884 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 217180-217208 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 56295-56323 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 65280-65308 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 54633-54661 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 101257-101285 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP047680 Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence 47146-47174 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029583 Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence 54757-54785 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 162847-162875 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018886 Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence 149462-149490 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP039809 Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence 119400-119428 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 174500-174528 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 104082-104110 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 59502-59530 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP040025 Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence 90333-90361 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 184380-184408 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 173575-173603 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 286904-286932 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026174 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence 84360-84388 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028995 Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence 92149-92177 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031851 Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence 88055-88083 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP033402 Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence 121260-121288 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 190354-190382 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MK191023 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence 47182-47210 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041648 Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence 80338-80366 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP031583 Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence 23332-23360 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP027044 Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence 4418-4446 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 145155-145183 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021544 Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence 115986-116014 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021540 Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence 119926-119954 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP021686 Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence 168008-168036 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024040 Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence 57548-57576 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP033947 Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence 83037-83065 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 174352-174380 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 KT896504 Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence 113990-114018 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 177965-177993 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 95486-95514 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 29053-29081 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028553 Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence 56358-56386 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP009879 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence 74660-74688 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP046950 Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence 131905-131933 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP032181 Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence 36654-36682 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP009115 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence 45147-45175 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP048381 Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence 108822-108850 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026396 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence 73498-73526 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP026397 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence 23162-23190 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 41961-41989 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 159859-159887 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP025966 Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence 68358-68386 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP020072 Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence 109343-109371 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP015386 Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence 139506-139534 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024537 Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence 87940-87968 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024516 Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence 171812-171840 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP028930 Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence 11335-11363 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP050170 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence 93122-93150 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP050168 Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence 59468-59496 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052276 Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence 121185-121213 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP016922 Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence 96958-96986 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP034679 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence 72235-72263 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 177810-177838 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052298 Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence 123259-123287 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_LR130549 Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2 146531-146559 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP046382 Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence 131886-131914 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP022574 Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence 29609-29637 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP024459 Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence 123361-123389 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 159162-159190 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP052540 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence 34984-35012 5 0.828
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP018670 Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence 135546-135574 5 0.828
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 KJ433975 Mycobacterium phage 40BC, complete genome 23232-23260 5 0.828
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 KJ433973 Mycobacterium phage 39HC, complete genome 23232-23260 5 0.828
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 NC_024145 Mycobacterium phage Hosp, complete genome 21428-21456 5 0.828
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 899524-899551 5 0.821
NC_005810_3 3.8|2539371|26|NC_005810|PILER-CR 2539371-2539396 26 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14982-15007 5 0.808
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK820641 Gordonia phage EnalisNailo, complete genome 34089-34119 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK878898 Gordonia phage Zameen, complete genome 34514-34544 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK919483 Gordonia phage Suscepit, complete genome 34515-34545 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK284520 Gordonia phage Lilas, complete genome 35800-35830 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK016492 Gordonia phage Bialota, complete genome 35266-35296 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK820642 Gordonia phage Polly, complete genome 33957-33987 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NC_041883 Gordonia phage Attis, complete genome 31647-31677 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 KJ433975 Mycobacterium phage 40BC, complete genome 23232-23262 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK814755 Gordonia phage Antonio, complete genome 34514-34544 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK875796 Gordonia phage Tayonia, complete genome 34514-34544 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK801734 Gordonia phage LordFarquaad, complete genome 31628-31658 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 MK433274 Gordonia phage Bradissa, complete genome 34555-34585 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 KJ433973 Mycobacterium phage 39HC, complete genome 23232-23262 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 KU963257 Gordonia phage Kita, complete genome 34523-34553 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NC_031251 Gordonia phage SoilAssassin, complete genome 31646-31676 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NC_031097 Gordonia phage Zirinka, complete genome 35254-35284 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NC_024145 Mycobacterium phage Hosp, complete genome 21428-21458 6 0.806
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 138555-138585 6 0.806
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69637-69665 6 0.793
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 57315-57343 6 0.793
NC_005810_3 3.6|2539369|27|NC_005810|CRT 2539369-2539395 27 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 820290-820316 6 0.778
NC_005810_3 3.6|2539369|27|NC_005810|CRT 2539369-2539395 27 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 815358-815384 6 0.778
NC_005810_3 3.6|2539369|27|NC_005810|CRT 2539369-2539395 27 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2185928-2185954 6 0.778
NC_005810_3 3.6|2539369|27|NC_005810|CRT 2539369-2539395 27 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2180996-2181022 6 0.778
NC_005810_3 3.6|2539369|27|NC_005810|CRT 2539369-2539395 27 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14981-15007 6 0.778
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30497-30524 6 0.786
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 KJ433975 Mycobacterium phage 40BC, complete genome 23232-23259 6 0.786
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 KJ433973 Mycobacterium phage 39HC, complete genome 23232-23259 6 0.786
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NC_024145 Mycobacterium phage Hosp, complete genome 21428-21455 6 0.786
NC_005810_3 3.1|2539247|31|NC_005810|CRISPRCasFinder 2539247-2539277 31 CP049262 Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence 69637-69667 7 0.774
NC_005810_3 3.3|2539367|29|NC_005810|CRISPRCasFinder 2539367-2539395 29 NZ_CP024873 Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence 14979-15007 7 0.759
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP041669 Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence 43412-43440 7 0.759
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_021594 Serratia plymuthica 4Rx13 plasmid p75, complete sequence 50110-50138 7 0.759
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_MH909329 Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence 95512-95540 7 0.759
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30497-30525 7 0.759
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK820641 Gordonia phage EnalisNailo, complete genome 34089-34116 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK878898 Gordonia phage Zameen, complete genome 34514-34541 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK919483 Gordonia phage Suscepit, complete genome 34515-34542 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK284520 Gordonia phage Lilas, complete genome 35800-35827 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK016492 Gordonia phage Bialota, complete genome 35266-35293 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK820642 Gordonia phage Polly, complete genome 33957-33984 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NC_041883 Gordonia phage Attis, complete genome 31647-31674 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK814755 Gordonia phage Antonio, complete genome 34514-34541 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK875796 Gordonia phage Tayonia, complete genome 34514-34541 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK801734 Gordonia phage LordFarquaad, complete genome 31628-31655 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 MK433274 Gordonia phage Bradissa, complete genome 34555-34582 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 KU963257 Gordonia phage Kita, complete genome 34523-34550 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NC_031251 Gordonia phage SoilAssassin, complete genome 31646-31673 7 0.75
NC_005810_3 3.7|2539311|28|NC_005810|PILER-CR 2539311-2539338 28 NC_031097 Gordonia phage Zirinka, complete genome 35254-35281 7 0.75
NC_005810_3 3.3|2539367|29|NC_005810|CRISPRCasFinder 2539367-2539395 29 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 820290-820318 8 0.724
NC_005810_3 3.3|2539367|29|NC_005810|CRISPRCasFinder 2539367-2539395 29 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 815356-815384 8 0.724
NC_005810_3 3.3|2539367|29|NC_005810|CRISPRCasFinder 2539367-2539395 29 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2185928-2185956 8 0.724
NC_005810_3 3.3|2539367|29|NC_005810|CRISPRCasFinder 2539367-2539395 29 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2180994-2181022 8 0.724
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 MN842294 Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence 61765-61793 8 0.724
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NZ_CP039222 Piscirickettsia salmonis strain NVI 5692 plasmid unnamed3, complete sequence 5411-5439 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK820641 Gordonia phage EnalisNailo, complete genome 34089-34117 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK878898 Gordonia phage Zameen, complete genome 34514-34542 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK919483 Gordonia phage Suscepit, complete genome 34515-34543 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK284520 Gordonia phage Lilas, complete genome 35800-35828 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK016492 Gordonia phage Bialota, complete genome 35266-35294 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK820642 Gordonia phage Polly, complete genome 33957-33985 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 NC_041883 Gordonia phage Attis, complete genome 31647-31675 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK814755 Gordonia phage Antonio, complete genome 34514-34542 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK875796 Gordonia phage Tayonia, complete genome 34514-34542 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK801734 Gordonia phage LordFarquaad, complete genome 31628-31656 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 MK433274 Gordonia phage Bradissa, complete genome 34555-34583 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 KU963257 Gordonia phage Kita, complete genome 34523-34551 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 NC_031251 Gordonia phage SoilAssassin, complete genome 31646-31674 8 0.724
NC_005810_3 3.5|2539309|29|NC_005810|CRT 2539309-2539337 29 NC_031097 Gordonia phage Zirinka, complete genome 35254-35282 8 0.724
NC_005810_1 1.2|1223444|33|NC_005810|CRISPRCasFinder,CRT,PILER-CR 1223444-1223476 33 NZ_CP040366 Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence 923-955 9 0.727
NC_005810_3 3.2|2539307|31|NC_005810|CRISPRCasFinder 2539307-2539337 31 NZ_JX627581 Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence 30497-30527 9 0.71
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_017570 Shewanella baltica BA175 plasmid pSBAL17501, complete sequence 42387-42415 9 0.69
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_011664 Shewanella baltica OS223 plasmid pS22301, complete sequence 63265-63293 9 0.69
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_011665 Shewanella baltica OS223 plasmid pS22303, complete sequence 43080-43108 9 0.69
NC_005810_3 3.4|2539249|29|NC_005810|CRT 2539249-2539277 29 NC_011668 Shewanella baltica OS223 plasmid pS22302, complete sequence 6154-6182 9 0.69

1. spacer 1.1|1223384|32|NC_005810|CRISPRCasFinder,CRT matches to MT374852 (Yersinia phage vB_YpM_3, complete genome) position: , mismatch: 0, identity: 1.0

tctgtacgcataccgccatcttgcatcagtct	CRISPR spacer
tctgtacgcataccgccatcttgcatcagtct	Protospacer
********************************

2. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.897

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gggtgactggcgcacaatgtctttcatga	Protospacer
.** ******** ****************

3. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

4. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026280 (Klebsiella oxytoca strain KONIH2 plasmid pKPC-55bf, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

5. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

6. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018675 (Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

7. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP050860 (Klebsiella pneumoniae strain SCH6109 plasmid pSCH6109-Vir, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

8. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052330 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

9. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052169 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

10. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY093014 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382s, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

11. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY093013 (Klebsiella aerogenes strain Eaer-4382 plasmid pEaer-4382b, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

12. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY270849 (Klebsiella pneumoniae strain 0716 plasmid p0716-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

13. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY174332 (Klebsiella pneumoniae strain 1220 plasmid p1220-CTXM, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

14. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY271407 (Klebsiella pneumoniae strain CIV-4 plasmid pKPN3-307_typeD, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

15. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP032195 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

16. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP032198 (Klebsiella pneumoniae strain AR_0097 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

17. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KX839208 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

18. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KU295133 (Escherichia coli strain BK33689 plasmid pBK33689, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

19. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KU665642 (Klebsiella pneumoniae strain K47-25 plasmid pG12-KPC-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

20. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KX236178 (Klebsiella pneumoniae strain HS091147 plasmid pHS091147, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

21. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KJ721790 (Klebsiella pneumoniae strain TpeVGH151 plasmid pVGH151, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

22. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KP125893 (Klebsiella pneumoniae subsp. pneumoniae strain HS08204 plasmid pHS08204, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

23. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KU295132 (Escherichia coli strain BK34397 plasmid pBK34397, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

24. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025142 (Klebsiella pneumoniae strain KP1768 plasmid KP1768_p2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

25. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024917 (Klebsiella pneumoniae strain NH54 plasmid pKPNH54.1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

26. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

27. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031262 (Klebsiella quasipneumoniae strain L22 plasmid pL22-5, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

28. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026135 (Klebsiella pneumoniae strain F5 plasmid pF5_3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

29. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018434 (Klebsiella pneumoniae strain MNCRE53 plasmid pMNCRE53_4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

30. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052164 (Klebsiella pneumoniae strain F16KP0082 plasmid pF16KP0082-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

31. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP043049 (Klebsiella pneumoniae strain KLP268 plasmid pKLP268-3) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

32. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014005 (Klebsiella pneumoniae subsp. pneumoniae strain NUHL24835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

33. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

34. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP048351 (Raoultella ornithinolytica strain 23 plasmid p23_B, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

35. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034282 (Klebsiella pneumoniae strain I72 plasmid p72_FIBkpn, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

36. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP037444 (Klebsiella sp. PO552 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

37. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP019900 (Raoultella planticola strain GODA plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

38. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_009649 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

39. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_009650 (Klebsiella pneumoniae subsp. pneumoniae MGH 78578 plasmid pKPN4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

40. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP049601 (Klebsiella aerogenes strain 18-2341 plasmid pSECR18-2341_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

41. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

42. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014650 (Klebsiella pneumoniae strain KPNIH36 plasmid pKpQIL-6e6, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

43. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011977 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-218.836kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

44. spacer 3.4|2539249|29|NC_005810|CRT matches to MN200129 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-IncFII-114, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

45. spacer 3.4|2539249|29|NC_005810|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

46. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041928 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

47. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP010393 (Klebsiella pneumoniae strain 34618 plasmid p34618-207.543kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

48. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KJ721789 (Klebsiella pneumoniae strain NJ HT1872 plasmid pUSKPC3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

49. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020523 (Escherichia coli strain 190 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

50. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

51. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052566 (Klebsiella pneumoniae strain A16KP0127 plasmid pA16KP0127-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

52. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052364 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

53. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

54. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_021502 (Klebsiella pneumoniae plasmid pKPoxa-48N2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

55. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

56. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

57. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

58. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027037 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

59. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_019389 (Klebsiella pneumoniae plasmid pKDO1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

60. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023332 (Klebsiella pneumoniae strain ST48 plasmid pKP09085, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

61. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

62. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023334 (Klebsiella pneumoniae strain ST15 plasmid pKP02022, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

63. spacer 3.4|2539249|29|NC_005810|CRT matches to HG969996 (Klebsiella pneumoniae plasmid pIT-12C47, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

64. spacer 3.4|2539249|29|NC_005810|CRT matches to HG969997 (Klebsiella pneumoniae plasmid pIT-01C22, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

65. spacer 3.4|2539249|29|NC_005810|CRT matches to HG969998 (Klebsiella pneumoniae plasmid pIT-11C07, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

66. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020499 (Klebsiella pneumoniae strain BWHC1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

67. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025038 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

68. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025039 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

69. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018693 (Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

70. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034777 (Klebsiella pneumoniae strain 18CPO060 plasmid pKPCKP060, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

71. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011986 (Klebsiella pneumoniae UHKPC07 plasmid pUHKPC07-113.639kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

72. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020855 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

73. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

74. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020851 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

75. spacer 3.4|2539249|29|NC_005810|CRT matches to MN891683 (Klebsiella pneumoniae strain 314013 plasmid p314013-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

76. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052358 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

77. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011981 (Klebsiella pneumoniae 500_1420 plasmid p500_1420-130.552kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

78. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011990 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-162.533kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

79. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011991 (Klebsiella pneumoniae UHKPC33 plasmid pUHKPC33-113.638kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

80. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027054 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncFIB IncFII) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

81. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036321 (Klebsiella pneumoniae strain VBA2172 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

82. spacer 3.4|2539249|29|NC_005810|CRT matches to MT129535 (Klebsiella aerogenes strain 18-1644 plasmid pSECR18-1644_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

83. spacer 3.4|2539249|29|NC_005810|CRT matches to MG700548 (Klebsiella pneumoniae strain UR15381 plasmid pUJ-1KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

84. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_FO834904 (Klebsiella pneumoniae strain Kp52.145 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

85. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018424 (Klebsiella pneumoniae strain MNCRE69 plasmid pMNCRE69_4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

86. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_015154 (Klebsiella pneumoniae plasmid pc15-k, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

87. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_025187 (Klebsiella pneumoniae strain BK26633 plasmid pKpQIL-234, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

88. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029591 (Klebsiella pneumoniae strain DA33144 plasmid pDA33144-220, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

89. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP023840 (Klebsiella pneumoniae strain 4/1-2 plasmid p4_1_2.1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

90. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_014016 (Klebsiella pneumoniae plasmid pKpQIL, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

91. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

92. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018992 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

93. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_016966 (Klebsiella pneumoniae plasmid pUUH239.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

94. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_025166 (Klebsiella pneumoniae strain BK30799 plasmid pKpQIL-10, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

95. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027614 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

96. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP009275 (Klebsiella variicola strain DX120E plasmid pKV1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

97. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025212 (Klebsiella pneumoniae strain HZW25 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

98. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022698 (Citrobacter farmeri strain AUSMDU00008141 plasmid pAUSMDU8141-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

99. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021959 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

100. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_025131 (Klebsiella pneumoniae strain BK30683 plasmid pBK30683, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

101. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012571 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5.X, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

102. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012572 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6.X, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

103. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028993 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

104. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029136 (Klebsiella pneumoniae strain AR376 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

105. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052553 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

106. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014121 (Klebsiella pneumoniae strain FDAARGOS_156 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

107. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041640 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-MPH, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

108. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

109. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026752 (Klebsiella pneumoniae strain AR_0066 plasmid tig00000080_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

110. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029102 (Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

111. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036193 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

112. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026181 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-6a23, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

113. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029000 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

114. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP039525 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-88K, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

115. spacer 3.4|2539249|29|NC_005810|CRT matches to KY798505 (Klebsiella pneumoniae plasmid pKpQIL-D1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

116. spacer 3.4|2539249|29|NC_005810|CRT matches to KY798506 (Escherichia coli plasmid pKpQIL-D2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

117. spacer 3.4|2539249|29|NC_005810|CRT matches to KY798507 (Klebsiella pneumoniae plasmid pKpQIL-UK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

118. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP010363 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-139.941kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

119. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018355 (Klebsiella pneumoniae strain CAV1453 plasmid pCAV1453-208, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

120. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021166 (Klebsiella pneumoniae strain 203 plasmid p203, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

121. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031614 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

122. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

123. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

124. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052564 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

125. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021541 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

126. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022926 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

127. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052526 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

128. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP017851 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2b, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

129. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_AP019690 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

130. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP017286 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

131. spacer 3.4|2539249|29|NC_005810|CRT matches to LT009688 (Klebsiella pneumoniae plasmid pIT-06C07, strain O6CO7, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

132. spacer 3.4|2539249|29|NC_005810|CRT matches to CP008701 (Klebsiella variicola strain Kp5-1 plasmid pKp5-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

133. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP030067 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

134. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP009777 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH32 plasmid pKPN-a68, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

135. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP008833 (Klebsiella pneumoniae subsp. pneumoniae KPR0928 plasmid pKpQIL-531, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

136. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP008800 (Klebsiella pneumoniae subsp. pneumoniae KPNIH24 plasmid pKPN-e44, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

137. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044038 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

138. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP046943 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed4) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

139. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP006927 (Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

140. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP008930 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

141. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

142. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_025167 (Escherichia coli strain BK28960 plasmid pKpQIL-Ec, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

143. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_022609 (Klebsiella pneumoniae strain N11-0042 plasmid pKp11-42, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

144. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052287 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

145. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052288 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

146. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP017281 (Klebsiella variicola strain GJ1 plasmid pKPGJ-1b, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

147. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018999 (Escherichia coli strain Ecol_AZ153 plasmid pECAZ153_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

148. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022825 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

149. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_011281 (Klebsiella variicola strain 342 plasmid pKP91, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

150. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020065 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

151. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020109 (Klebsiella pneumoniae strain AR_0098 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

152. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015387 (Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

153. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020069 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

154. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012566 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-5, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

155. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012567 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-6, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

156. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034322 (Klebsiella pneumoniae strain 33 plasmid pK033_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

157. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036443 (Klebsiella pneumoniae strain ABFPV plasmid tig00001208_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

158. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP050379 (Klebsiella pneumoniae strain 51015 plasmid p51015_CTX_M_15, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

159. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035907 (Klebsiella pneumoniae strain BA4656 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

160. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_032103 (Klebsiella pneumoniae strain 628 plasmid p628-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

161. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

162. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034131 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_136.4Kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

163. spacer 3.4|2539249|29|NC_005810|CRT matches to CP050155 (Klebsiella quasipneumoniae plasmid Carbapenemase(IMP-4)_IncFI, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

164. spacer 3.4|2539249|29|NC_005810|CRT matches to MF918373 (Klebsiella pneumoniae plasmid p1512-dfrA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

165. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_021199 (Klebsiella pneumoniae subsp. pneumoniae KPX plasmid pKPX-2 DNA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

166. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022613 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

167. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012884 (Klebsiella pneumoniae KP-1 plasmid pKP1-19, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

168. spacer 3.4|2539249|29|NC_005810|CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

169. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP030343 (Klebsiella pneumoniae strain AR_362 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

170. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035384 (Klebsiella pneumoniae strain AP8555 plasmid pAP855, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

171. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026148 (Klebsiella pneumoniae strain F132 plasmid pF132_3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

172. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

173. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052538 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

174. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP023916 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

175. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018460 (Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

176. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020903 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

177. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020904 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

178. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP045676 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

179. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052535 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

180. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

181. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

182. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034137 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_150.8Kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

183. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034140 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_84.1Kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

184. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027049 (Klebsiella pneumoniae strain 20_GR_12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

185. spacer 3.4|2539249|29|NC_005810|CRT matches to MN823998 (Klebsiella pneumoniae strain 161116753 plasmid p116753-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

186. spacer 3.4|2539249|29|NC_005810|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

187. spacer 3.4|2539249|29|NC_005810|CRT matches to MN824002 (Klebsiella pneumoniae strain N201205880 plasmid p205880-2FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

188. spacer 3.4|2539249|29|NC_005810|CRT matches to MN615880 (Serratia marcescens strain S1 plasmid pS1-KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

189. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014669 (Escherichia coli strain ECONIH2 plasmid pKpQIL-571, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

190. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024510 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

191. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP032186 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

192. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027152 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

193. spacer 3.4|2539249|29|NC_005810|CRT matches to MN823984 (Serratia marcescens strain 201315732 plasmid p15732-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

194. spacer 3.4|2539249|29|NC_005810|CRT matches to MN823986 (Klebsiella pneumoniae strain 201332306 plasmid p332306-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

195. spacer 3.4|2539249|29|NC_005810|CRT matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

196. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015824 (Klebsiella pneumoniae isolate blood sample 2 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

197. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044390 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

198. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044391 (Klebsiella pneumoniae strain 2018N17-066 plasmid p2018N17-066-2_MCR8, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

199. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044394 (Klebsiella pneumoniae strain 2018N16-148 plasmid p2018N16-148-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

200. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

201. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052374 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

202. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

203. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018365 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

204. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_AP018673 (Klebsiella pneumoniae strain GSU10-3 plasmid pGSU10-3-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

205. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036439 (Klebsiella pneumoniae strain ABFQB plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

206. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_020132 (Klebsiella pneumoniae strain BK32179 plasmid pBK32179, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

207. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_024992 (Klebsiella pneumoniae plasmid pKp848CTX, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

208. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011621 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-78, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

209. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

210. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021946 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000195, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

211. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022917 (Klebsiella pneumoniae strain ST307PT04 plasmid pJYC04A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

212. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

213. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

214. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031369 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

215. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041937 (Klebsiella pneumoniae strain KP14003 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

216. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

217. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052438 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

218. spacer 3.4|2539249|29|NC_005810|CRT matches to HG969995 (Klebsiella pneumoniae plasmid pIT-01C03, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

219. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024543 (Klebsiella pneumoniae strain INF042 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

220. spacer 3.4|2539249|29|NC_005810|CRT matches to AP022358 (Klebsiella pneumoniae E278 plasmid pE278_IMP6 DNA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

221. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

222. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_013950 (Klebsiella pneumoniae plasmid pKF3-94, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

223. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018340 (Klebsiella pneumoniae isolate Kp_Goe_154414 plasmid pKp_Goe_414-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

224. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP045691 (Klebsiella pneumoniae strain TK421 plasmid pTK421_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtatctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

225. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_LR025089 (Klebsiella pneumoniae isolate KP980 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

226. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP054266 (Klebsiella pneumoniae strain 39427 plasmid pKPN39427.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

227. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023904 (Klebsiella pneumoniae strain Kpn-1780 plasmid pKP1780-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

228. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023905 (Klebsiella pneumoniae strain Kpn-1870 plasmid pKP1870-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

229. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023906 (Klebsiella pneumoniae strain Kpn-3913 plasmid pKP3913-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

230. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

231. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044387 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

232. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021951 (Klebsiella pneumoniae strain AR_0148 plasmid tig00000168_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

233. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

234. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_023903 (Klebsiella pneumoniae strain Kpn-1504 plasmid pKP1504-kpc, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

235. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026016 (Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

236. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025145 (Klebsiella pneumoniae strain NR5632 plasmid NR5632_p2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

237. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025148 (Klebsiella pneumoniae strain KP1766 plasmid KP1766_p2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

238. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_LR792630 (Klebsiella pneumoniae isolate SB5881 plasmid SB5881_I) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

239. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036188 (Klebsiella pneumoniae strain BA1559 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

240. spacer 3.4|2539249|29|NC_005810|CRT matches to MK649823 (Klebsiella pneumoniae strain BA6740 plasmid pBA6740_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

241. spacer 3.4|2539249|29|NC_005810|CRT matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

242. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015383 (Klebsiella pneumoniae strain CN1 plasmid pCN1_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

243. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

244. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014765 (Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

245. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026588 (Klebsiella pneumoniae strain NUHL30457 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

246. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052338 (Klebsiella pneumoniae strain D17KP0018 plasmid pD17KP0018-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

247. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027696 (Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

248. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_LT882698 (Klebsiella pneumoniae strain Klebsiella pneumoniae KLPN57 isolate KLPN57 plasmid I, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

249. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MK262711 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29mcr-8.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

250. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MK104259 (Klebsiella pneumoniae strain LC3 plasmid pHNLC3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

251. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MK167989 (Klebsiella pneumoniae strain 6YF2CTX plasmid pHNYF2-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

252. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MK773536 (Klebsiella pneumoniae strain QDE2 plasmid pQDE2-B, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

253. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP016812 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_incR_DHQP1002001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

254. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MH917122 (Klebsiella pneumoniae strain Kp715 plasmid pSZF_KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

255. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MG878868 (Klebsiella pneumoniae strain Kp21774 plasmid pKp21774-135, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

256. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_019390 (Klebsiella pneumoniae plasmid pKPN_CZ, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

257. spacer 3.4|2539249|29|NC_005810|CRT matches to MN657248 (Enterobacteriaceae bacterium strain 22-16 plasmid pKP15-T2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

258. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

259. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014777 (Pluralibacter gergoviae strain FB2 plasmid pFB2.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

260. spacer 3.4|2539249|29|NC_005810|CRT matches to MK347425 (Klebsiella pneumoniae strain AHM7C8I plasmid pHNAH8I-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

261. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MF156708 (Klebsiella pneumoniae strain 13294 plasmid p13294-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

262. spacer 3.4|2539249|29|NC_005810|CRT matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

263. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035536 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

264. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY271404 (Klebsiella pneumoniae strain Kp-48 plasmid pKPN3-307_typeA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

265. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

266. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MG288683 (Klebsiella aerogenes strain E20 plasmid pE20-NR, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

267. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MF788069 (Raoultella ornithinolytica strain 23141 plasmid p23141-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

268. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MF788070 (Raoultella ornithinolytica strain 23141 plasmid p23141-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

269. spacer 3.4|2539249|29|NC_005810|CRT matches to LR134219 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 3) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

270. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

271. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP033755 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

272. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022923 (Klebsiella pneumoniae strain ST307PT02 plasmid pJYC02A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

273. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034407 (Klebsiella pneumoniae strain NH34 plasmid pNH34.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

274. spacer 3.4|2539249|29|NC_005810|CRT matches to MN661404 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

275. spacer 3.4|2539249|29|NC_005810|CRT matches to LK391770 (Klebsiella pneumoniae plasmid pRYC11, complete sequence, strain H67) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

276. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026048 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

277. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

278. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052168 (Klebsiella pneumoniae strain F16KP0075 plasmid pF16KP0075-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

279. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY454639 (Klebsiella pneumoniae strain INF167 plasmid INF167_p0001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

280. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY270850 (Klebsiella pneumoniae strain 12181 plasmid p12181-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

281. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KY271403 (Klebsiella pneumoniae strain Kp_48 plasmid pKpQIL-307_48, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

282. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

283. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

284. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029740 (Klebsiella pneumoniae strain AR_0087 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

285. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KP008371 (Klebsiella pneumoniae strain 565 plasmid PKPCAPSS, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

286. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_KT203286 (Klebsiella pneumoniae strain U25 plasmid PU25001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

287. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_020087 (Klebsiella pneumoniae plasmid pK1HV, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

288. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021752 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

289. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP044529 (Klebsiella grimontii strain SS141 plasmid plamid_2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

290. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022125 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

291. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP017386 (Klebsiella pneumoniae strain KP36 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

292. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018441 (Klebsiella pneumoniae strain Kp_Goe_822917 plasmid pKp_Goe_917-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

293. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP040123 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

294. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029588 (Klebsiella pneumoniae strain DA33141 plasmid pDA33141-217, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

295. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP037744 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_amr, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

296. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052408 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

297. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

298. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035216 (Klebsiella michiganensis strain M82255 plasmid pKOCBH-B, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

299. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

300. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_AP018754 (Klebsiella pneumoniae strain KP67 plasmid pKP6701, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

301. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024193 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

302. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052401 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

303. spacer 3.4|2539249|29|NC_005810|CRT matches to MN543580 (Klebsiella pneumoniae strain PM48 plasmid pPM48_125, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

304. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026276 (Klebsiella oxytoca strain KONIH5 plasmid pKOR-ab4d, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatttctttcatga	Protospacer
*** . ****** ***** **********

305. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

306. spacer 3.4|2539249|29|NC_005810|CRT matches to MN543573 (Klebsiella pneumoniae strain GH44 plasmid pGH44_216, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

307. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025468 (Klebsiella pneumoniae strain JS187 plasmid p187-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

308. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028954 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

309. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP033627 (Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

310. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036302 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid p1_015093, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

311. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036328 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIBpQil, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

312. spacer 3.4|2539249|29|NC_005810|CRT matches to MN586817 (Klebsiella pneumoniae strain A1966 plasmid pA1966-NR, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

313. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_LR130542 (Klebsiella pneumoniae strain AJ218 isolate AJ218 plasmid 2) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

314. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

315. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

316. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015135 (Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

317. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020842 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

318. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020843 (Klebsiella pneumoniae strain KPN1482 plasmid pKPN1482-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

319. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031811 (Klebsiella pneumoniae strain INF014-sc-2279884 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

320. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP032832 (Klebsiella pneumoniae strain INF078 plasmid pINF078-VP, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

321. spacer 3.4|2539249|29|NC_005810|CRT matches to MN891675 (Klebsiella pneumoniae strain 358573 plasmid p358573-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

322. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041949 (Klebsiella pneumoniae strain KP2 plasmid pKP2_3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

323. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020838 (Klebsiella pneumoniae strain BK13043 plasmid pBK13043-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

324. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028784 (Klebsiella pneumoniae strain SCKP020049 plasmid p1_020049, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

325. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035776 (Klebsiella pneumoniae strain R46 plasmid pR46-270, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

326. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

327. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052218 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

328. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_019155 (Klebsiella pneumoniae plasmid pKpQIL-IT, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

329. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

330. spacer 3.4|2539249|29|NC_005810|CRT matches to MN310379 (Klebsiella quasipneumoniae strain A2508 plasmid pA2508-NR, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

331. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

332. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031735 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM501, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

333. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028177 (Klebsiella pneumoniae strain CFSAN054111 plasmid pGMI16-006_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

334. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP047686 (Serratia marcescens strain 2838 plasmid p2838-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

335. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018815 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

336. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP037966 (Klebsiella pneumoniae strain SCKP020135 plasmid p1_020135, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

337. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052148 (Klebsiella pneumoniae strain F16KP0108 plasmid pF16KP0108-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

338. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041084 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

339. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026271 (Klebsiella oxytoca strain KONIH4 plasmid pKOX-4655, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

340. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022442 (Klebsiella sp. LY plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

341. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036337 (Klebsiella pneumoniae strain BP327 plasmid pIncFIBK, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

342. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052415 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

343. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041094 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

344. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041100 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

345. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021834 (Klebsiella pneumoniae strain AR_0120 plasmid tig00000500_pilon, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

346. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027613 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

347. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027616 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

348. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024876 (Klebsiella pneumoniae strain NH25 plasmid pNH25.2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

349. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022692 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_01, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

350. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022693 (Klebsiella pneumoniae subsp. pneumoniae strain AUSMDU00008079 plasmid pAUSMDU00008079_02, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

351. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP047683 (Serratia marcescens strain 3024 plasmid p3024-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

352. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022920 (Klebsiella pneumoniae strain ST307PT03 plasmid pJYC03A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

353. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

354. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

355. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP035181 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

356. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

357. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

358. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP047680 (Serratia marcescens strain 4201 plasmid p4201-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

359. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029583 (Klebsiella pneumoniae strain DA33140 plasmid pDA33140-112, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

360. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

361. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018886 (Klebsiella pneumoniae subsp. pneumoniae strain BR21 plasmid pIncF, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

362. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP039809 (Klebsiella pneumoniae strain C2660 plasmid pC2660-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

363. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029101 (Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

364. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

365. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggaatctggcgtacaatctctttcatga	Protospacer
***.. ****** ***** **********

366. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP040025 (Klebsiella pneumoniae strain KPC160132 plasmid pKpn3-L132, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

367. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

368. spacer 3.4|2539249|29|NC_005810|CRT matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

369. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

370. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026174 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-0d7f, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

371. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028995 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

372. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031851 (Klebsiella pneumoniae strain 121 plasmid pKP121-2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

373. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP033402 (Klebsiella pneumoniae strain WCHKP115069 plasmid p1_115069, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

374. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

375. spacer 3.4|2539249|29|NC_005810|CRT matches to MK191023 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-KPC, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

376. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041648 (Klebsiella pneumoniae strain NKU_KlebA1 plasmid pKlebA1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

377. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP031583 (Klebsiella pneumoniae strain N4b plasmid pIncFII-1502320, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

378. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP027044 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

379. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

380. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021544 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000000, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

381. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021540 (Klebsiella pneumoniae strain AR_0047 plasmid tig00000001, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

382. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP021686 (Klebsiella pneumoniae strain AR_0146 plasmid tig00001160, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

383. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024040 (Klebsiella pneumoniae strain QS17-0029 plasmid pMR0617ctx, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

384. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP033947 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

385. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

386. spacer 3.4|2539249|29|NC_005810|CRT matches to KT896504 (Klebsiella pneumoniae strain I11 plasmid pKPSH11, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

387. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

388. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

389. spacer 3.4|2539249|29|NC_005810|CRT matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

390. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028553 (Klebsiella variicola strain WCHKP19 plasmid pCTXM15_020019, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

391. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP009879 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH31 plasmid pKPN-c22, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

392. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP046950 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

393. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP032181 (Citrobacter freundii strain AR_0116 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

394. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP009115 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

395. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP048381 (Klebsiella variicola strain 118 plasmid p118_B-OXA1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

396. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026396 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-8c6e, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

397. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP026397 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-10f7, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

398. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

399. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

400. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP025966 (Klebsiella pneumoniae strain WCHKP34 plasmid pQnrB_LL34, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

401. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP020072 (Klebsiella pneumoniae strain AR_0115 plasmid tig00000002, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

402. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP015386 (Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

403. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024537 (Klebsiella pneumoniae strain KSB1_9D plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

404. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024516 (Klebsiella pneumoniae strain KSB1_10J plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

405. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP028930 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

406. spacer 3.4|2539249|29|NC_005810|CRT matches to CP050170 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFII, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

407. spacer 3.4|2539249|29|NC_005810|CRT matches to CP050168 (Klebsiella pneumoniae plasmid Carbapenemase(KPC-2)_IncFIB, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

408. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052276 (Klebsiella pneumoniae strain E16KP0241 plasmid pE16KP0241-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

409. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP016922 (Klebsiella pneumoniae isolate 11 plasmid pIncFIB_DHQP1300920, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

410. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP034679 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_83kb, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

411. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

412. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052298 (Klebsiella pneumoniae strain E16KP0204 plasmid pE16KP0204-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

413. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_LR130549 (Klebsiella pneumoniae strain KPC2 isolate KPC2 plasmid 2) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

414. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP046382 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

415. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP022574 (Klebsiella pneumoniae strain BIC-1 plasmid pBIC-1a, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

416. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP024459 (Klebsiella pneumoniae strain QS17-0161 plasmid pMR0617aac, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

417. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcatctggcgtacaatctctttcatga	Protospacer
*** . ****** ***** **********

418. spacer 3.4|2539249|29|NC_005810|CRT matches to CP052540 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-3, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggtacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

419. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP018670 (Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence) position: , mismatch: 5, identity: 0.828

aggggactggcgaacaatgtctttcatga	CRISPR spacer
aggcacctggcgcacaatctctttcatga	Protospacer
*** . ****** ***** **********

420. spacer 3.5|2539309|29|NC_005810|CRT matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 5, identity: 0.828

-gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 ***. .***** ***.*************

421. spacer 3.5|2539309|29|NC_005810|CRT matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 5, identity: 0.828

-gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 ***. .***** ***.*************

422. spacer 3.5|2539309|29|NC_005810|CRT matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 5, identity: 0.828

-gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 ***. .***** ***.*************

423. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.821

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
caactccctgaacctgagcccgttcgcc	Protospacer
* *.*** *********** ******* 

424. spacer 3.8|2539371|26|NC_005810|PILER-CR matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 5, identity: 0.808

gtcaaacaaatttaggcgacgattta	CRISPR spacer
ctcaaacaagttgaggcgacgattct	Protospacer
 ********.** ***********. 

425. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

426. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

427. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

428. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

429. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

430. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

431. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

432. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 .****. .***** ***.*************

433. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

434. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

435. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

436. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

437. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 .****. .***** ***.*************

438. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

439. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

440. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtcgtc-cgccgtgatcctgagcgcgctcgcg	Protospacer
 ***.* . ****** **********.*****

441. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 6, identity: 0.806

-tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cccgccg-cccgtgtacccgagcgcgttcgcg	Protospacer
 .****. .***** ***.*************

442. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 6, identity: 0.806

tcgccattccgtgaacctgagcgcgttcgcg--	CRISPR spacer
tcgcctttccctgaacctga--gcgatcgtgac	Protospacer
***** **** *********  *** ***.*  

443. spacer 3.4|2539249|29|NC_005810|CRT matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 6, identity: 0.793

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gtcgcgctggcgaacaatctctttcatga	Protospacer
.  * .************ **********

444. spacer 3.4|2539249|29|NC_005810|CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 6, identity: 0.793

aggggactggcgaacaatgtctttcatga	CRISPR spacer
cggtacctggcgcacaatctctttcatga	Protospacer
 ** . ****** ***** **********

445. spacer 3.6|2539369|27|NC_005810|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778

ggtcaaacaaatttaggcgacgattta	CRISPR spacer
ggtcaaacaaatttaggcaaggagccg	Protospacer
******************.* ** ...

446. spacer 3.6|2539369|27|NC_005810|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.778

ggtcaaacaaatttaggcgacgattta	CRISPR spacer
ggtcaaacaaatttaggcaaggagccg	Protospacer
******************.* ** ...

447. spacer 3.6|2539369|27|NC_005810|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.778

ggtcaaacaaatttaggcgacgattta	CRISPR spacer
ggtcaaacaaatttaggcaaggagccg	Protospacer
******************.* ** ...

448. spacer 3.6|2539369|27|NC_005810|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.778

ggtcaaacaaatttaggcgacgattta	CRISPR spacer
ggtcaaacaaatttaggcaaggagccg	Protospacer
******************.* ** ...

449. spacer 3.6|2539369|27|NC_005810|CRT matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 6, identity: 0.778

ggtcaaacaaatttaggcgacgattta	CRISPR spacer
actcaaacaagttgaggcgacgattct	Protospacer
. ********.** ***********. 

450. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 6, identity: 0.786

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
acgagccgtgaacctcagcgcattcgcg	Protospacer
 *.  ********** *****.******

451. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to KJ433975 (Mycobacterium phage 40BC, complete genome) position: , mismatch: 6, identity: 0.786

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gccgcccgtgtacccgagcgcgttcgcg	Protospacer
 *  .***** ***.*************

452. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to KJ433973 (Mycobacterium phage 39HC, complete genome) position: , mismatch: 6, identity: 0.786

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gccgcccgtgtacccgagcgcgttcgcg	Protospacer
 *  .***** ***.*************

453. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NC_024145 (Mycobacterium phage Hosp, complete genome) position: , mismatch: 6, identity: 0.786

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gccgcccgtgtacccgagcgcgttcgcg	Protospacer
 *  .***** ***.*************

454. spacer 3.1|2539247|31|NC_005810|CRISPRCasFinder matches to CP049262 (Cronobacter sakazakii strain CS-09 plasmid pCsaCS09b, complete sequence) position: , mismatch: 7, identity: 0.774

tcaggggactggcgaacaatgtctttcatga	CRISPR spacer
acgtcgcgctggcgaacaatctctttcatga	Protospacer
 *.  * .************ **********

455. spacer 3.3|2539367|29|NC_005810|CRISPRCasFinder matches to NZ_CP024873 (Leptospira mayottensis 200901116 plasmid p1_L200901116, complete sequence) position: , mismatch: 7, identity: 0.759

tcggtcaaacaaatttaggcgacgattta	CRISPR spacer
ttactcaaacaagttgaggcgacgattct	Protospacer
*.. ********.** ***********. 

456. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP041669 (Legionella israelensis strain L18-01051 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

aggggactggcgaacaatgtctttcatga	CRISPR spacer
tgttttttgtcgaacaatgtctttcatga	Protospacer
 *    .** *******************

457. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_021594 (Serratia plymuthica 4Rx13 plasmid p75, complete sequence) position: , mismatch: 7, identity: 0.759

aggggactggcgaacaatgtctttcatga	CRISPR spacer
cgcatcctgacgaacaatatctttcatga	Protospacer
 * .  ***.********.**********

458. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_MH909329 (Leclercia adecarboxylata strain 150707804 plasmid p707804-3FII, complete sequence) position: , mismatch: 7, identity: 0.759

aggggactggcgaacaatgtctttcatga	CRISPR spacer
atccttctggcgcacaatctctttcatga	Protospacer
*     ****** ***** **********

459. spacer 3.5|2539309|29|NC_005810|CRT matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 7, identity: 0.759

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
aacgagccgtgaacctcagcgcattcgcg	Protospacer
. *.  ********** *****.******

460. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

461. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

462. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

463. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

464. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

465. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

466. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

467. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

468. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

469. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

470. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

471. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

472. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

473. spacer 3.7|2539311|28|NC_005810|PILER-CR matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 7, identity: 0.75

ccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
gtccgccgtgatcctgagcgcgctcgcg	Protospacer
 . . ****** **********.*****

474. spacer 3.3|2539367|29|NC_005810|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.724

tcggtcaaacaaatttaggcgacgattta	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccg	Protospacer
 .******************.* ** ...

475. spacer 3.3|2539367|29|NC_005810|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.724

tcggtcaaacaaatttaggcgacgattta	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccg	Protospacer
 .******************.* ** ...

476. spacer 3.3|2539367|29|NC_005810|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.724

tcggtcaaacaaatttaggcgacgattta	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccg	Protospacer
 .******************.* ** ...

477. spacer 3.3|2539367|29|NC_005810|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.724

tcggtcaaacaaatttaggcgacgattta	CRISPR spacer
gtggtcaaacaaatttaggcaaggagccg	Protospacer
 .******************.* ** ...

478. spacer 3.4|2539249|29|NC_005810|CRT matches to MN842294 (Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence) position: , mismatch: 8, identity: 0.724

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gtctttctggcggacaatttctttcatga	Protospacer
.     ******.***** **********

479. spacer 3.4|2539249|29|NC_005810|CRT matches to NZ_CP039222 (Piscirickettsia salmonis strain NVI 5692 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.724

aggggactggcgaacaatgtctttcatga	CRISPR spacer
tggggagtggcgaacaatgtctaaacttg	Protospacer
 ***** ***************    * .

480. spacer 3.5|2539309|29|NC_005810|CRT matches to MK820641 (Gordonia phage EnalisNailo, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

481. spacer 3.5|2539309|29|NC_005810|CRT matches to MK878898 (Gordonia phage Zameen, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

482. spacer 3.5|2539309|29|NC_005810|CRT matches to MK919483 (Gordonia phage Suscepit, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

483. spacer 3.5|2539309|29|NC_005810|CRT matches to MK284520 (Gordonia phage Lilas, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

484. spacer 3.5|2539309|29|NC_005810|CRT matches to MK016492 (Gordonia phage Bialota, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

485. spacer 3.5|2539309|29|NC_005810|CRT matches to MK820642 (Gordonia phage Polly, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

486. spacer 3.5|2539309|29|NC_005810|CRT matches to NC_041883 (Gordonia phage Attis, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

487. spacer 3.5|2539309|29|NC_005810|CRT matches to MK814755 (Gordonia phage Antonio, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

488. spacer 3.5|2539309|29|NC_005810|CRT matches to MK875796 (Gordonia phage Tayonia, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

489. spacer 3.5|2539309|29|NC_005810|CRT matches to MK801734 (Gordonia phage LordFarquaad, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

490. spacer 3.5|2539309|29|NC_005810|CRT matches to MK433274 (Gordonia phage Bradissa, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

491. spacer 3.5|2539309|29|NC_005810|CRT matches to KU963257 (Gordonia phage Kita, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

492. spacer 3.5|2539309|29|NC_005810|CRT matches to NC_031251 (Gordonia phage SoilAssassin, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

493. spacer 3.5|2539309|29|NC_005810|CRT matches to NC_031097 (Gordonia phage Zirinka, complete genome) position: , mismatch: 8, identity: 0.724

gccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
cgtccgccgtgatcctgagcgcgctcgcg	Protospacer
  . . ****** **********.*****

494. spacer 1.2|1223444|33|NC_005810|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040366 (Bacillus flexus isolate 1-2-1 plasmid punnamed3, complete sequence) position: , mismatch: 9, identity: 0.727

agcaaaaatcttaattacatctgatgatttcgg	CRISPR spacer
ggaaaaaaacttaattacatctgataatccatt	Protospacer
.* ***** ****************.**..   

495. spacer 3.2|2539307|31|NC_005810|CRISPRCasFinder matches to NZ_JX627581 (Methylobacterium oryzae CBMB20 plasmid pMOC2, complete sequence) position: , mismatch: 9, identity: 0.71

tcgccattccgtgaacctgagcgcgttcgcg	CRISPR spacer
ctaacgagccgtgaacctcagcgcattcgcg	Protospacer
... *.  ********** *****.******

496. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_017570 (Shewanella baltica BA175 plasmid pSBAL17501, complete sequence) position: , mismatch: 9, identity: 0.69

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gttctgttggcgcacaatgtctttcatgg	Protospacer
.    ..***** ***************.

497. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_011664 (Shewanella baltica OS223 plasmid pS22301, complete sequence) position: , mismatch: 9, identity: 0.69

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gttctgttggcgcacaatgtctttcatgg	Protospacer
.    ..***** ***************.

498. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_011665 (Shewanella baltica OS223 plasmid pS22303, complete sequence) position: , mismatch: 9, identity: 0.69

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gttctgttggcgcacaatgtctttcatgg	Protospacer
.    ..***** ***************.

499. spacer 3.4|2539249|29|NC_005810|CRT matches to NC_011668 (Shewanella baltica OS223 plasmid pS22302, complete sequence) position: , mismatch: 9, identity: 0.69

aggggactggcgaacaatgtctttcatga	CRISPR spacer
gttctgttggcgcacaatgtctttcatgg	Protospacer
.    ..***** ***************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 80242 : 131041 44 Bacillus_phage(30.0%) transposase,tRNA,protease NA
DBSCAN-SWA_2 570190 : 632856 60 Bacillus_phage(18.75%) transposase,protease,tRNA NA
DBSCAN-SWA_3 907149 : 943192 39 Saccharomonospora_phage(22.22%) transposase,tRNA,integrase,protease attL 925429:925444|attR 942414:942429
DBSCAN-SWA_4 953198 : 997815 38 Pseudomonas_phage(25.0%) tail,protease,coat,plate NA
DBSCAN-SWA_5 1038349 : 1074565 30 Saccharomonospora_phage(27.27%) holin,transposase,tRNA NA
DBSCAN-SWA_6 1144409 : 1153551 11 Escherichia_phage(28.57%) transposase NA
DBSCAN-SWA_7 1334232 : 1343854 8 Brazilian_cedratvirus(16.67%) transposase,tRNA,protease NA
DBSCAN-SWA_8 1453425 : 1517440 50 Escherichia_phage(25.0%) transposase,plate NA
DBSCAN-SWA_9 1878213 : 1906906 25 Escherichia_phage(33.33%) transposase,coat NA
DBSCAN-SWA_10 2144895 : 2156299 13 Escherichia_phage(20.0%) transposase,integrase attL 2144840:2144870|attR 2153810:2153840
DBSCAN-SWA_11 2797960 : 2854881 48 Saccharomonospora_phage(10.0%) transposase,tRNA,plate NA
DBSCAN-SWA_12 3929054 : 4005024 55 Staphylococcus_phage(20.0%) transposase,protease,tRNA,plate NA
DBSCAN-SWA_13 4112798 : 4188723 55 Escherichia_phage(16.67%) transposase,plate NA
DBSCAN-SWA_14 4313308 : 4379371 60 Escherichia_phage(11.76%) transposase,protease,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_005813
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44638 : 69110 22 Enterobacteria_phage(50.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage