1. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
2. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
3. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
4. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
5. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
6. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
7. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 8, identity: 0.75
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
cactgtgcttcggtgaggcctttttcaggggc Protospacer
* ..** ******.*************..* *
8. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
atcccggctacggcgaggcctttttccaaggg Protospacer
*.* ** **************** ***
9. spacer 1.1|702303|32|NC_002971|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cttcgtccttcggcgaggcctttttcaaagcc CRISPR spacer
tctcgtccatcggcgatgcctttttgttgagc Protospacer
..****** ******* ******** .. *