Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003317 Brucella melitensis bv. 1 str. 16M chromosome I, complete sequence 1 crisprs csa3,DEDDh 0 1 3 0
NC_003318 Brucella melitensis bv. 1 str. 16M chromosome II, complete sequence 0 crisprs DEDDh,csa3,cas3 0 0 0 0

Results visualization

1. NC_003317
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003317_1 1346969-1347051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_003317_1 1.1|1346997|27|NC_003317|CRISPRCasFinder 1346997-1347023 27 NZ_CP013986 Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence 45587-45613 5 0.815

1. spacer 1.1|1346997|27|NC_003317|CRISPRCasFinder matches to NZ_CP013986 (Klebsiella variicola strain LMG 23571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

acagatctttccttgcgcgcatcttat	CRISPR spacer
tcagatctttccttgagagcatctgtt	Protospacer
 ************** * ******  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1040487 : 1050508 15 Brucella_phage(37.5%) transposase,integrase attL 1035485:1035525|attR 1050586:1050626
DBSCAN-SWA_2 1119539 : 1131467 13 uncultured_Mediterranean_phage(90.0%) tRNA NA
DBSCAN-SWA_3 1356176 : 1403283 41 Mesorhizobium_phage(14.29%) tail,portal,integrase,protease attL 1346976:1346990|attR 1360420:1360434
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage