Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013793 Bacillus pseudofirmus OF4 plasmid pBpOF4-02, complete sequence 0 crisprs csa3 0 0 0 0
NC_013791 Bacillus pseudofirmus OF4, complete sequence 2 crisprs csa3,WYL,cas3,DinG,DEDDh 0 0 2 0
NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 1 crisprs cas14j,csa3,RT,cas14k 0 1 0 0

Results visualization

1. NC_013791
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013791_1 3142858-3142953 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013791_2 3593513-3593629 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 350241 : 360045 9 Cyanophage(25.0%) NA NA
DBSCAN-SWA_2 1395667 : 1401850 8 Staphylococcus_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_013792
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013792_1 175709-175800 TypeV NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013792_1 1.1|175738|34|NC_013792|CRISPRCasFinder 175738-175771 34 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 175738-175771 0 1.0
NC_013792_1 1.1|175738|34|NC_013792|CRISPRCasFinder 175738-175771 34 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 175824-175857 4 0.882

1. spacer 1.1|175738|34|NC_013792|CRISPRCasFinder matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 0, identity: 1.0

tttacggagtgcagtacccctttacggagtacag	CRISPR spacer
tttacggagtgcagtacccctttacggagtacag	Protospacer
**********************************

2. spacer 1.1|175738|34|NC_013792|CRISPRCasFinder matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 4, identity: 0.882

tttacggagtgcagtacccctttacggagtacag	CRISPR spacer
tagacggagtgcagtaccccctttcggagtacag	Protospacer
*  *****************.** **********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage