Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR214951 Mycoplasma neurolyticum strain NCTC10166 genome assembly, chromosome: 1 1 crisprs NA 0 1 0 0
LR214954 Mycoplasma neurolyticum strain NCTC10166 genome assembly, plasmid: 4 0 crisprs NA 0 0 0 0
LR214952 Mycoplasma neurolyticum strain NCTC10166 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR214953 Mycoplasma neurolyticum strain NCTC10166 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0

Results visualization

1. LR214951
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR214951_1 721542-721640 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR214951_1 1.1|721566|51|LR214951|CRISPRCasFinder 721566-721616 51 NZ_LR214953 Mycoplasma neurolyticum strain NCTC10166 plasmid 3 11834-11884 1 0.98

1. spacer 1.1|721566|51|LR214951|CRISPRCasFinder matches to NZ_LR214953 (Mycoplasma neurolyticum strain NCTC10166 plasmid 3) position: , mismatch: 1, identity: 0.98

aacataataaaaatataatacatagtattataacttctaaaaaaaaatcat-	CRISPR spacer
aacataataaaaatataatacatagtattataacttct-aaaaaaaatcatt	Protospacer
************************************** ************ 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage