Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR214943 Mycoplasma orale strain NCTC10112 genome assembly, plasmid: 4 0 crisprs NA 0 0 0 0
LR214940 Mycoplasma orale strain NCTC10112 genome assembly, chromosome: 1 1 crisprs NA 0 1 0 0
LR214944 Mycoplasma orale strain NCTC10112 genome assembly, plasmid: 5 0 crisprs NA 0 0 0 0
LR214941 Mycoplasma orale strain NCTC10112 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR214942 Mycoplasma orale strain NCTC10112 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0

Results visualization

1. LR214940
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR214940_2 674217-674319 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NZ_CP033120 Acinetobacter wuhouensis strain WCHAW010062 plasmid p11_010062, complete sequence 3310-3337 4 0.857
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NZ_CP012975 Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence 12741-12768 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NZ_CP047853 Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence 7248-7275 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NZ_CP047836 Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence 16610-16637 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NC_013550 Staphylococcus aureus plasmid pBORa53, complete sequence 7969-7996 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 AP013412 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C10A-MedDCM-OCT-S46-C61 24992-25019 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 609751-609778 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 MN693005 Marine virus AFVG_117M50, complete genome 55465-55492 6 0.786
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 LC377538 Staphylococcus aureus plasmid pNTUH_3874 NTUH_3874 DNA, complete sequence 40669-40696 7 0.75
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 120487-120514 7 0.75
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 MK327941 Escherichia phage vB_EcoM_G37-3, complete genome 57466-57493 7 0.75
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NC_011836 Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence 35699-35726 8 0.714
LR214940_1 1.1|240319|28|LR214940|CRISPRCasFinder 240319-240346 28 NC_009466 Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence 10876-10903 8 0.714

1. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP033120 (Acinetobacter wuhouensis strain WCHAW010062 plasmid p11_010062, complete sequence) position: , mismatch: 4, identity: 0.857

ttacgaagttaaaaataatat--attgcca	CRISPR spacer
ttactaagttaaaaataatatcaatttc--	Protospacer
**** ****************  *** *  

2. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
atacgaagttaaaaaaaatatatgactc	Protospacer
 ************** ******* .*. 

3. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
atacgaagttaaaaaaaatatatgactc	Protospacer
 ************** ******* .*. 

4. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
atacgaagttaaaaaaaatatatgactc	Protospacer
 ************** ******* .*. 

5. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
atacgaagttaaaaaaaatatatgactc	Protospacer
 ************** ******* .*. 

6. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to AP013412 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C10A-MedDCM-OCT-S46-C61) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
caggggagttaaaaataatataatgcca	Protospacer
. . *.**************** *****

7. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
ttacaaagttagaaataatatatataaa	Protospacer
****.******.***********    *

8. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 6, identity: 0.786

ttacgaagttaaaaataatatattgcca	CRISPR spacer
gtacgaagataaaaattatatatttcat	Protospacer
 ******* ******* ******* *  

9. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to LC377538 (Staphylococcus aureus plasmid pNTUH_3874 NTUH_3874 DNA, complete sequence) position: , mismatch: 7, identity: 0.75

ttacgaagttaaaaataatatattgcca	CRISPR spacer
gtacgaagttaacaataatattttagtt	Protospacer
 *********** ******** **. . 

10. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 7, identity: 0.75

ttacgaagttaaaaataatatattgcca	CRISPR spacer
cttcgaagttaaaattaatatattttgt	Protospacer
.* *********** ********* .  

11. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 7, identity: 0.75

ttacgaagttaaaaataatatattgcca	CRISPR spacer
ctacgaagttaaaaaaaacatattcttg	Protospacer
.************** **.***** ...

12. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_011836 (Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence) position: , mismatch: 8, identity: 0.714

ttacgaagttaaaaataatatattgcca	CRISPR spacer
aggcgaagttaaaaataatatatgtgag	Protospacer
  .********************    .

13. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_009466 (Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence) position: , mismatch: 8, identity: 0.714

ttacgaagttaaaaataatatattgcca	CRISPR spacer
aggcgaagttaaaaataatatatgtgag	Protospacer
  .********************    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage