Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR135255 Enterococcus faecium isolate E7098 genome assembly, plasmid: 2 1 crisprs NA 0 2 0 0
LR135257 Enterococcus faecium isolate E7098 genome assembly, plasmid: 4 0 crisprs NA 0 0 0 0
LR135254 Enterococcus faecium isolate E7098 genome assembly, chromosome: 1 1 crisprs NA 0 0 0 0
LR135256 Enterococcus faecium isolate E7098 genome assembly, plasmid: 3 1 crisprs NA 1 4 0 0

Results visualization

1. LR135256
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR135256_1 11209-11377 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 LR135257.1 8492-8521 1 0.967

1. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to position: 8492-8521, mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 11556-11585 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 11095-11124 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 11245-11274 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135490 Enterococcus faecium isolate E8414 plasmid 3 8061-8090 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR134109 Enterococcus faecium isolate E6043 plasmid 5 6272-6301 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 55977-56006 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 98745-98774 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 16748-16777 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 52172-52201 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 60989-61018 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 2478-2507 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 20569-20598 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 43272-43301 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 8438-8467 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 2729-2758 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 136818-136847 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 85396-85425 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 6151-6180 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135199 Enterococcus faecium isolate E6055 plasmid 3 4724-4753 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 4819-4848 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123904-123933 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 4724-4753 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 4819-4848 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 78217-78246 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 71708-71737 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 183278-183307 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 39531-39560 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 90519-90548 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 4819-4848 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 136752-136781 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 11622-11651 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 85330-85359 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 11161-11190 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 11311-11340 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135490 Enterococcus faecium isolate E8414 plasmid 3 8127-8156 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123772-123801 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123838-123867 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR134109 Enterococcus faecium isolate E6043 plasmid 5 6338-6367 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 78151-78180 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 2544-2573 0 1.0
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 8504-8533 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 11554-11580 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 11093-11119 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 11243-11269 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135490 Enterococcus faecium isolate E8414 plasmid 3 8059-8085 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR134109 Enterococcus faecium isolate E6043 plasmid 5 6270-6296 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 MN831413 Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence 16746-16772 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 2476-2502 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040238 Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence 20567-20593 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 8436-8462 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LT598665 Enterococcus faecium isolate Ef_aus00233 plasmid 3 2727-2753 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 136823-136849 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 85401-85427 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123909-123935 0 1.0
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 78222-78248 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP025427 Enterococcus faecium strain SC4 plasmid p2, complete sequence 136753-136781 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP027511 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence 85331-85359 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123773-123801 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP044266 Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence 123839-123867 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP041272 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2 78152-78180 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP041263 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2 11622-11650 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135245 Enterococcus faecium isolate E6988 plasmid 3 11161-11189 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135256 Enterococcus faecium isolate E7098 plasmid 3 11311-11339 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135490 Enterococcus faecium isolate E8414 plasmid 3 8127-8155 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR134109 Enterococcus faecium isolate E6043 plasmid 5 6338-6366 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP039730 Enterococcus faecium strain ZY2 plasmid pZY2 2544-2572 0 1.0
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_MG640601 Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence 8504-8532 0 1.0
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 46726-46755 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 104418-104447 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 90078-90107 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 287701-287730 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 115579-115608 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 12157-12186 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 75629-75658 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135280 Enterococcus faecium isolate E6975 plasmid 3 47725-47754 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 6959-6988 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 86388-86417 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 97412-97441 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP015517 Enterococcus hirae strain R17 plasmid, complete sequence 8507-8536 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 92662-92691 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 47623-47652 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 29112-29141 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 35530-35559 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP019974 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence 44725-44754 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 11096-11125 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP012463 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence 43131-43160 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 164278-164307 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP011283 Enterococcus faecium strain E39 plasmid p2, complete sequence 6434-6463 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP015123 Enterococcus faecium strain E39 plasmid p3, complete sequence 6754-6783 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_KP342511 Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence 20782-20811 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 LT603680 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3 4724-4753 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 15130-15159 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 CP003352 Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 4836-4865 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041264 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence 8493-8522 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 8376-8405 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027499 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 4836-4865 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135289 Enterococcus faecium isolate E7199 plasmid 3 12894-12923 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 4368-4397 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 157892-157921 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 4447-4476 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP013010 Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence 62592-62621 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 6259-6288 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 4447-4476 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135257 Enterococcus faecium isolate E7098 plasmid 4 8492-8521 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 7114-7143 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041254 Enterococcus faecium strain 515 plasmid p169, complete sequence 59573-59602 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NC_021995 Enterococcus faecium Aus0085 plasmid p2, complete sequence 6705-6734 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP017799 Enterococcus faecium strain E243 plasmid unnamed2, complete sequence 6754-6783 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 4368-4397 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 5434-5463 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 6151-6180 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 4447-4476 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135207 Enterococcus faecium isolate E7171 plasmid 5 4724-4753 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 5492-5521 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135228 Enterococcus faecium isolate E7025 plasmid 3 4724-4753 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 8774-8803 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135221 Enterococcus faecium isolate E7040 plasmid 3 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135326 Enterococcus faecium isolate E7654 plasmid 3 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 4836-4865 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135319 Enterococcus faecium isolate E7663 plasmid 3 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 6338-6367 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 6420-6449 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 4368-4397 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 4368-4397 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 206632-206661 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 6151-6180 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023425 Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence 8492-8521 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041273 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence 8492-8521 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 45021-45050 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 7871-7900 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 7707-7736 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP017794 Enterococcus faecium strain E240 plasmid unnamed2, complete sequence 6727-6756 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 5492-5521 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 6259-6288 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 5434-5463 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 4835-4864 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 118208-118237 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135309 Enterococcus faecium isolate E7240 plasmid 3 40225-40254 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 4836-4865 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 1645-1674 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023812 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence 6709-6738 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP033208 Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence 4725-4754 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 65568-65597 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 9108-9137 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 15130-15159 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 29948-29977 1 0.967
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LT598666 Enterococcus faecium isolate Ef_aus00233 plasmid 4 6709-6738 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP020486 Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence 1020-1049 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP027519 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence 18673-18702 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135300 Enterococcus faecium isolate E7429 plasmid 4 10919-10948 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135342 Enterococcus faecium isolate E7356 plasmid 4 28089-28118 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135295 Enterococcus faecium isolate E7237 plasmid 3 4028-4057 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NC_010880 Enterococcus faecium plasmid pEF1, complete sequence 14006-14035 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135491 Enterococcus faecium isolate E8414 plasmid 4 27218-27247 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135366 Enterococcus faecium isolate E8195 plasmid 3 20506-20535 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135403 Enterococcus faecium isolate E8377 plasmid 3 8916-8945 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135396 Enterococcus faecium isolate E8290 plasmid 3 54027-54056 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135346 Enterococcus faecium isolate E8202 plasmid 3 16823-16852 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135353 Enterococcus faecium isolate E8014 plasmid 3 32700-32729 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR135387 Enterococcus faecium isolate E7933 plasmid 4 27113-27142 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_LR134110 Enterococcus faecium isolate E6043 plasmid 6 8200-8229 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP044276 Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence 9617-9646 1 0.967
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP018067 Enterococcus faecium strain E1 plasmid pE1_29, complete sequence 7321-7350 1 0.967
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 55975-56001 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 98743-98769 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 52170-52196 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 60987-61013 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 43270-43296 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 6156-6182 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135199 Enterococcus faecium isolate E6055 plasmid 3 4729-4755 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 4824-4850 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135374 Enterococcus faecium isolate E8172 plasmid 3 4729-4755 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 4824-4850 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 71713-71739 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 183283-183309 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 39536-39562 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 90524-90550 1 0.963
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 4824-4850 1 0.963
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP020486 Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence 1021-1049 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP027519 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence 18674-18702 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135342 Enterococcus faecium isolate E7356 plasmid 4 28090-28118 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135295 Enterococcus faecium isolate E7237 plasmid 3 4029-4057 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NC_010880 Enterococcus faecium plasmid pEF1, complete sequence 14007-14035 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135346 Enterococcus faecium isolate E8202 plasmid 3 16824-16852 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135353 Enterococcus faecium isolate E8014 plasmid 3 32701-32729 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR134110 Enterococcus faecium isolate E6043 plasmid 6 8201-8229 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP018067 Enterococcus faecium strain E1 plasmid pE1_29, complete sequence 7322-7350 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135300 Enterococcus faecium isolate E7429 plasmid 4 10919-10947 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135491 Enterococcus faecium isolate E8414 plasmid 4 27218-27246 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135366 Enterococcus faecium isolate E8195 plasmid 3 20506-20534 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135403 Enterococcus faecium isolate E8377 plasmid 3 8916-8944 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135396 Enterococcus faecium isolate E8290 plasmid 3 54027-54055 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_LR135387 Enterococcus faecium isolate E7933 plasmid 4 27113-27141 1 0.966
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP044276 Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence 9617-9645 1 0.966
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 352516-352545 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 215527-215556 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135246 Enterococcus faecium isolate E6988 plasmid 4 6851-6880 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135237 Enterococcus faecium isolate E7067 plasmid 3 5683-5712 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135261 Enterococcus faecium isolate E4457 plasmid 4 37696-37725 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP041258 Enterococcus faecium strain 515 plasmid p27, complete sequence 75811-75840 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135222 Enterococcus faecium isolate E7040 plasmid 4 48704-48733 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR134108 Enterococcus faecium isolate E6043 plasmid 4 42202-42231 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 102245-102274 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027508 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence 4743-4772 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027503 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence 4744-4773 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP027514 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence 4744-4773 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135238 Enterococcus faecium isolate E7067 plasmid 4 4725-4754 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135205 Enterococcus faecium isolate E7171 plasmid 3 30099-30128 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 7707-7736 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135386 Enterococcus faecium isolate E7933 plasmid 3 10383-10412 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP014534 Enterococcus faecium strain E745 plasmid pl5, complete sequence 23844-23873 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 10087-10116 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 6150-6179 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 6150-6179 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 6150-6179 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 6151-6180 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_LR135193 Enterococcus faecium isolate E4438 plasmid 3 4724-4753 2 0.933
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP012432 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence 37702-37731 2 0.933
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 215525-215551 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 46724-46750 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 104416-104442 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 90076-90102 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 287699-287725 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 352514-352540 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 115577-115603 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 12155-12181 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018070 Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence 75627-75653 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135246 Enterococcus faecium isolate E6988 plasmid 4 6849-6875 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135280 Enterococcus faecium isolate E6975 plasmid 3 47723-47749 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135237 Enterococcus faecium isolate E7067 plasmid 3 5681-5707 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135261 Enterococcus faecium isolate E4457 plasmid 4 37694-37720 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041258 Enterococcus faecium strain 515 plasmid p27, complete sequence 75809-75835 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135477 Enterococcus faecium isolate E8423 plasmid 3 6957-6983 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135222 Enterococcus faecium isolate E7040 plasmid 4 48702-48728 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 86386-86412 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 97410-97436 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR134108 Enterococcus faecium isolate E6043 plasmid 4 42200-42226 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP015517 Enterococcus hirae strain R17 plasmid, complete sequence 8505-8531 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 92660-92686 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 47621-47647 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 29110-29136 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 35528-35554 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP019974 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence 44723-44749 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 11094-11120 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP012463 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence 43129-43155 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 164276-164302 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP011283 Enterococcus faecium strain E39 plasmid p2, complete sequence 6439-6465 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP015123 Enterococcus faecium strain E39 plasmid p3, complete sequence 6759-6785 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_KP342511 Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence 20787-20813 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 LT603680 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3 4729-4755 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 15135-15161 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 CP003352 Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 102250-102276 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 4841-4867 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041264 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence 8498-8524 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 8381-8407 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027499 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027508 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence 4748-4774 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 4841-4867 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027503 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence 4749-4775 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135289 Enterococcus faecium isolate E7199 plasmid 3 12899-12925 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 4373-4399 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 157897-157923 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 4452-4478 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP027514 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence 4749-4775 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP013010 Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence 62597-62623 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 6264-6290 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 4452-4478 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135257 Enterococcus faecium isolate E7098 plasmid 4 8497-8523 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135238 Enterococcus faecium isolate E7067 plasmid 4 4730-4756 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 7119-7145 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041254 Enterococcus faecium strain 515 plasmid p169, complete sequence 59578-59604 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NC_021995 Enterococcus faecium Aus0085 plasmid p2, complete sequence 6710-6736 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP017799 Enterococcus faecium strain E243 plasmid unnamed2, complete sequence 6759-6785 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 4373-4399 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 5439-5465 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 4452-4478 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135207 Enterococcus faecium isolate E7171 plasmid 5 4729-4755 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 5497-5523 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135228 Enterococcus faecium isolate E7025 plasmid 3 4729-4755 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 8779-8805 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135221 Enterococcus faecium isolate E7040 plasmid 3 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135326 Enterococcus faecium isolate E7654 plasmid 3 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135386 Enterococcus faecium isolate E7933 plasmid 3 10388-10414 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 4841-4867 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135319 Enterococcus faecium isolate E7663 plasmid 3 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 6343-6369 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 6425-6451 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 4373-4399 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 4373-4399 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 206637-206663 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP014534 Enterococcus faecium strain E745 plasmid pl5, complete sequence 23849-23875 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023425 Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence 8497-8523 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 10092-10118 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041273 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence 8497-8523 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 45026-45052 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 7876-7902 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 7712-7738 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP017794 Enterococcus faecium strain E240 plasmid unnamed2, complete sequence 6732-6758 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 6155-6181 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 6155-6181 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 6155-6181 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 5497-5523 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 6156-6182 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 6264-6290 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 5439-5465 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135193 Enterococcus faecium isolate E4438 plasmid 3 4729-4755 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 4840-4866 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP019971 Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence 118213-118239 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135309 Enterococcus faecium isolate E7240 plasmid 3 40230-40256 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 4841-4867 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 1650-1676 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023812 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence 6714-6740 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP033208 Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence 4730-4756 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 65573-65599 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 9113-9139 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 15135-15161 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP012432 Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence 37707-37733 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 29953-29979 2 0.926
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LT598666 Enterococcus faecium isolate Ef_aus00233 plasmid 4 6714-6740 2 0.926
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP040851 Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence 357-386 3 0.9
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 181272-181301 3 0.9
LR135256_1 1.1|11245|30|LR135256|CRISPRCasFinder 11245-11274 30 NZ_CP016165 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence 50319-50348 3 0.9
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP040851 Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence 355-381 3 0.889
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_LR135205 Enterococcus faecium isolate E7171 plasmid 3 30104-30130 3 0.889
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 181277-181303 3 0.889
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NZ_CP016165 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence 50324-50350 3 0.889
LR135256_1 1.3|11262|27|LR135256|PILER-CR 11262-11288 27 NC_022883 Enterococcus mundtii QU 25 plasmid pQY082, complete sequence 33166-33192 4 0.852
LR135256_1 1.4|11332|29|LR135256|PILER-CR 11332-11360 29 NZ_CP026693 Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence 109882-109910 7 0.759
LR135256_1 1.2|11311|30|LR135256|CRISPRCasFinder 11311-11340 30 NZ_CP026693 Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence 109881-109910 8 0.733

1. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

2. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

3. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

4. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

5. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

6. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

7. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

8. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

9. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

10. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

11. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

12. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

13. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

14. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

15. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

16. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

17. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

18. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

19. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

20. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

21. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

22. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

23. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

24. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

25. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

26. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

27. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

28. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

29. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

30. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

31. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

32. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

33. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

34. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

35. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

36. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

37. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

38. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

39. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

40. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

41. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

42. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

43. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

44. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

45. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

46. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

47. spacer 1.3|11262|27|LR135256|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

48. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

49. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

50. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

51. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

52. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

53. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

54. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

55. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

56. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

57. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

58. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

59. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

60. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

61. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

62. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

63. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

64. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

65. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

66. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

67. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

68. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

69. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

70. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

71. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

72. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

73. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

74. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

75. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

76. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

77. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

78. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

79. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

80. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

81. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

82. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

83. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

84. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP019974 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

85. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

86. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

87. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

88. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

89. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

90. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

91. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

92. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

93. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

94. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

95. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

96. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

97. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

98. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

99. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

100. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

101. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

102. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

103. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

104. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

105. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

106. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

107. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

108. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

109. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

110. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

111. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

112. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

113. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

114. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

115. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

116. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

117. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

118. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

119. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

120. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

121. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

122. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

123. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

124. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

125. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

126. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

127. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

128. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

129. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

130. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

131. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

132. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

133. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

134. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

135. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

136. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

137. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

138. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

139. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

140. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

141. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

142. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

143. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

144. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

145. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

146. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

147. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

148. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

149. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

150. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

151. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

152. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

153. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

154. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

155. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

156. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

157. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

158. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

159. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

160. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

161. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

162. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

163. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

164. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP020486 (Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

165. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP027519 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

166. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135300 (Enterococcus faecium isolate E7429 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

167. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135342 (Enterococcus faecium isolate E7356 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

168. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135295 (Enterococcus faecium isolate E7237 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

169. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NC_010880 (Enterococcus faecium plasmid pEF1, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

170. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135491 (Enterococcus faecium isolate E8414 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

171. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135366 (Enterococcus faecium isolate E8195 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

172. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135403 (Enterococcus faecium isolate E8377 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

173. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135396 (Enterococcus faecium isolate E8290 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

174. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135346 (Enterococcus faecium isolate E8202 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

175. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135353 (Enterococcus faecium isolate E8014 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

176. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135387 (Enterococcus faecium isolate E7933 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

177. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR134110 (Enterococcus faecium isolate E6043 plasmid 6) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

178. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044276 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

179. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP018067 (Enterococcus faecium strain E1 plasmid pE1_29, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

180. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

181. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

182. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

183. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

184. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

185. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

186. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

187. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

188. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

189. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

190. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

191. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

192. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

193. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

194. spacer 1.3|11262|27|LR135256|PILER-CR matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

195. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP020486 (Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

196. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP027519 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

197. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135342 (Enterococcus faecium isolate E7356 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

198. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135295 (Enterococcus faecium isolate E7237 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

199. spacer 1.4|11332|29|LR135256|PILER-CR matches to NC_010880 (Enterococcus faecium plasmid pEF1, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

200. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135346 (Enterococcus faecium isolate E8202 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

201. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135353 (Enterococcus faecium isolate E8014 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

202. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR134110 (Enterococcus faecium isolate E6043 plasmid 6) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

203. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP018067 (Enterococcus faecium strain E1 plasmid pE1_29, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

204. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135300 (Enterococcus faecium isolate E7429 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

205. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135491 (Enterococcus faecium isolate E8414 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

206. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135366 (Enterococcus faecium isolate E8195 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

207. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135403 (Enterococcus faecium isolate E8377 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

208. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135396 (Enterococcus faecium isolate E8290 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

209. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135387 (Enterococcus faecium isolate E7933 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

210. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044276 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

211. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

212. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

213. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

214. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

215. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

216. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

217. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

218. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

219. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

220. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

221. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

222. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

223. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

224. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

225. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

226. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacaccattaattaatttaaagtactc	Protospacer
******.****.******************

227. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

228. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

229. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

230. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

231. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

232. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

233. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtgctc	Protospacer
************.*************.***

234. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

235. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

236. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

237. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

238. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

239. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

240. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

241. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

242. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

243. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

244. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

245. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

246. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

247. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

248. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

249. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

250. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

251. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

252. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

253. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

254. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

255. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

256. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

257. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

258. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

259. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

260. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

261. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

262. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

263. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

264. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP019974 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

265. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

266. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

267. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

268. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

269. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

270. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

271. spacer 1.3|11262|27|LR135256|PILER-CR matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

272. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

273. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

274. spacer 1.3|11262|27|LR135256|PILER-CR matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

275. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

276. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

277. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

278. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

279. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

280. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

281. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

282. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

283. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

284. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

285. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

286. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

287. spacer 1.3|11262|27|LR135256|PILER-CR matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

288. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

289. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

290. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

291. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

292. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

293. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

294. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

295. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

296. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

297. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

298. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

299. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

300. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

301. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

302. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

303. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

304. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

305. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

306. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

307. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

308. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

309. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

310. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

311. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

312. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

313. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

314. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

315. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

316. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

317. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

318. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

319. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

320. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

321. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

322. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

323. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

324. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

325. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

326. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

327. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

328. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

329. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

330. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

331. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

332. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

333. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

334. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

335. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

336. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

337. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

338. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

339. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

340. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

341. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

342. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

343. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

344. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

345. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

346. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

347. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

348. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

349. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

350. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

351. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

352. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

353. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

354. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

355. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

356. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

357. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

358. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

359. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

360. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

361. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

362. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

363. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

364. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

365. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

366. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

367. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

368. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacaccattaattaatttaaag	Protospacer
 *******.****.*************

369. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

370. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

371. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_022883 (Enterococcus mundtii QU 25 plasmid pQY082, complete sequence) position: , mismatch: 4, identity: 0.852

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgatcaatttaaaa	Protospacer
 *************.**.********.

372. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP026693 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence) position: , mismatch: 7, identity: 0.759

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactggtagcaatttcccctatcagtgc	Protospacer
****** ************.****   . 

373. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP026693 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence) position: , mismatch: 8, identity: 0.733

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactggtagcaatttcccctatcagtgcc	Protospacer
****** ************.****   .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LR135257
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. LR135254
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR135254_1 2290506-2290615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. LR135255
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR135255_1 430-557 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221215-221254 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 452-491 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244126-244165 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27883-27922 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96547-96586 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 454-493 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 95091-95130 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358204-358243 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119936-119975 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111370-111409 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126934-126973 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153620-153659 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129211-129250 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71269-71308 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249117-249156 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107198-107237 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91401-91440 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102425-102464 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1397-1436 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60361-60400 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97676-97715 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52636-52675 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102650-102689 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200630-200669 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56542-56581 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65332-65371 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67328-67367 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14571-14610 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178898-178937 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33081-33120 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105709-105748 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39886-39925 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 35165-35204 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225612-225651 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92045-92084 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17088-17127 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86167-86206 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61653-61692 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5084-5123 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177278-177317 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244126-244165 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192112-192151 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 453-492 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168262-168301 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221173-221191 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040906 Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence 51712-51730 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 109405-109423 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358162-358180 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119894-119912 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153578-153596 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129169-129187 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249075-249093 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91359-91377 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102383-102401 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60319-60337 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97634-97652 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52594-52612 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102608-102626 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56500-56518 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65290-65308 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14529-14547 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33039-33057 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39844-39862 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92003-92021 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17046-17064 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 47586-47604 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192070-192088 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168220-168238 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 515-533 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244189-244207 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27946-27964 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96610-96628 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 517-535 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111433-111451 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126997-127015 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71332-71350 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107261-107279 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1460-1478 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP045013 Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200693-200711 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67391-67409 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040873 Enterococcus faecium strain DB-1 plasmid punnamed1 40046-40064 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040876 Enterococcus faecium strain DB-1 plasmid punnamed2 2896-2914 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178961-178979 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105772-105790 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225675-225693 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86230-86248 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61716-61734 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5147-5165 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177341-177359 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244189-244207 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 516-534 0 1.0
LR135255_1 1.2|516|19|LR135255|CRISPRCasFinder 516-534 19 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 516-534 0 1.0
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 109447-109486 1 0.975
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 453-492 1 0.975
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 453-492 1 0.975
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 47628-47667 1 0.975
LR135255_1 1.1|453|40|LR135255|CRISPRCasFinder 453-492 40 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 3358-3397 5 0.875

1. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

2. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

3. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

4. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

5. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

6. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

7. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

8. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

9. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

10. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

11. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

12. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

13. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

14. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

15. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

16. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

17. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

18. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

19. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

20. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

21. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

22. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

23. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

24. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

25. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

26. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

27. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

28. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

29. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

30. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

31. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

32. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

33. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

34. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

35. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

36. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

37. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

38. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

39. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

40. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

41. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

42. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

43. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

44. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

45. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

46. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

47. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

48. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

49. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

50. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

51. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

52. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

53. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

54. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

55. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

56. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

57. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

58. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

59. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

60. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

61. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

62. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

63. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

64. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

65. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

66. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

67. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

68. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

69. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

70. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

71. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

72. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

73. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

74. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

75. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

76. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

77. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

78. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

79. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

80. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

81. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

82. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

83. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

84. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

85. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

86. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

87. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

88. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

89. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

90. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

91. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

92. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

93. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

94. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

95. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

96. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

97. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

98. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

99. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

100. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

101. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

102. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

103. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

104. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

105. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

106. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

107. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

108. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

109. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

110. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

111. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

112. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

113. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

114. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

115. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

116. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

117. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

118. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

119. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

120. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

121. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

122. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

123. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

124. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

125. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

126. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

127. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

128. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

129. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

130. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

131. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

132. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

133. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

134. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

135. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

136. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

137. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

138. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

139. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

140. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

141. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

142. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

143. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

144. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

145. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

146. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

147. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

148. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

149. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

150. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

151. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

152. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

153. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

154. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

155. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

156. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

157. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

158. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

159. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

160. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

161. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

162. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

163. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

164. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

165. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

166. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

167. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

168. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

169. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

170. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

171. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

172. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

173. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

174. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

175. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

176. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

177. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

178. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

179. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

180. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

181. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

182. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

183. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

184. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

185. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

186. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

187. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

188. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

189. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

190. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

191. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

192. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

193. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

194. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

195. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

196. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

197. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

198. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

199. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

200. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

201. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

202. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

203. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

204. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

205. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

206. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

207. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

208. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

209. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

210. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

211. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

212. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

213. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

214. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

215. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

216. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

217. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

218. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

219. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

220. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

221. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

222. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

223. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

224. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

225. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

226. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

227. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

228. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

229. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

230. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

231. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

232. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

233. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
**.*************************************

234. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.875

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggctc	Protospacer
*******************************.* *** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage