Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR135185 Enterococcus faecium isolate E4413 genome assembly, chromosome: 1 1 crisprs NA 0 0 0 0
LR135190 Enterococcus faecium isolate E4413 genome assembly, plasmid: 6 0 crisprs NA 0 0 0 0
LR135187 Enterococcus faecium isolate E4413 genome assembly, plasmid: 3 0 crisprs NA 0 0 0 0
LR135188 Enterococcus faecium isolate E4413 genome assembly, plasmid: 4 0 crisprs NA 0 0 0 0
LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 1 crisprs NA 0 2 0 0
LR135189 Enterococcus faecium isolate E4413 genome assembly, plasmid: 5 0 crisprs NA 0 0 0 0

Results visualization

1. LR135185
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR135185_1 2161765-2161874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LR135186
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR135186_1 430-557 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP011282 Enterococcus faecium strain E39 plasmid p1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP025426 Enterococcus faecium strain SC4 plasmid p1, complete sequence 221215-221254 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 LT603679 Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2 452-491 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP018832 Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence 244126-244165 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040369 Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP043485 Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence 27883-27922 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP020485 Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence 96547-96586 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP041262 Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence 454-493 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP012385 Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence 95091-95130 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP013995 Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence 358204-358243 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP014450 Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence 119936-119975 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP018073 Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence 111370-111409 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027518 Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027498 Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027507 Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027502 Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135298 Enterococcus faecium isolate E7429 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135288 Enterococcus faecium isolate E7199 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135333 Enterococcus faecium isolate E7471 plasmid 3 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135340 Enterococcus faecium isolate E7356 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP046076 Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 MT074686 Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP025756 Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence 126934-126973 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027513 Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135244 Enterococcus faecium isolate E6988 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135279 Enterococcus faecium isolate E6975 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135783 Enterococcus faecium isolate E4239 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135294 Enterococcus faecium isolate E7237 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135255 Enterococcus faecium isolate E7098 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135236 Enterococcus faecium isolate E7067 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135198 Enterococcus faecium isolate E6055 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135259 Enterococcus faecium isolate E4457 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135182 Enterococcus faecium isolate E1774 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040905 Enterococcus faecium strain N56454 plasmid unnamed, complete sequence 153620-153659 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP041256 Enterococcus faecium strain 515 plasmid p26, complete sequence 129211-129250 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP019209 Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence 71269-71308 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP019989 Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence 249117-249156 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP017798 Enterococcus faecium strain E243 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135429 Enterococcus faecium isolate E8927 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135436 Enterococcus faecium isolate E8691 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135483 Enterococcus faecium isolate E4456 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135476 Enterococcus faecium isolate E8423 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135204 Enterococcus faecium isolate E7171 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135227 Enterococcus faecium isolate E7025 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135489 Enterococcus faecium isolate E8414 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135365 Enterococcus faecium isolate E8195 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135220 Enterococcus faecium isolate E7040 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135415 Enterococcus faecium isolate E8328 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135395 Enterococcus faecium isolate E8290 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NC_021987 Enterococcus faecium Aus0085 plasmid p1, complete sequence 107198-107237 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135345 Enterococcus faecium isolate E8202 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135325 Enterococcus faecium isolate E7654 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135358 Enterococcus faecium isolate E7948 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135409 Enterococcus faecium isolate E8284 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135352 Enterococcus faecium isolate E8014 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP050649 Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE 91401-91440 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP050651 Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT 102425-102464 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135385 Enterococcus faecium isolate E7933 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP044265 Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135318 Enterococcus faecium isolate E7663 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR134106 Enterococcus faecium isolate E6043 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135373 Enterococcus faecium isolate E8172 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP006031 Enterococcus faecium T110 plasmid pEFT110, complete sequence 1397-1436 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP011829 Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence 60361-60400 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_AP019395 Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LN999988 Enterococcus faecium isolate EFE11651 plasmid II, complete sequence 97676-97715 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP033042 Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence 52636-52675 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP025687 Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence 102650-102689 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040741 Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP014530 Enterococcus faecium strain E745 plasmid pl1, complete sequence 200630-200669 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023424 Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_AP022342 Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040877 Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence 56542-56581 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 65332-65371 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040704 Enterococcus faecium strain HOU503 plasmid p1, complete sequence 67328-67367 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP044275 Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP017793 Enterococcus faecium strain E240 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP019993 Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence 14571-14610 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035655 Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023790 Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023800 Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035137 Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence 178898-178937 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035661 Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035667 Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NC_017963 Enterococcus faecium DO plasmid 3, complete sequence 33081-33120 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035649 Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040850 Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence 105709-105748 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP042840 Enterococcus sp. DA9 plasmid unnamed4 39886-39925 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135171 Enterococcus faecium isolate E4227 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135192 Enterococcus faecium isolate E4438 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP041271 Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 35165-35204 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135308 Enterococcus faecium isolate E7240 plasmid 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP040237 Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP018066 Enterococcus faecium strain E1 plasmid pE1_230, complete sequence 225612-225651 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023809 Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP033207 Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence 92045-92084 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP018129 Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence 17088-17127 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023805 Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP035221 Enterococcus faecium strain SRCM103470 plasmid unnamed1 86167-86206 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_AP019409 Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NC_020208 Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence 61653-61692 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP034948 Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence 5084-5123 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP016164 Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence 177278-177317 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP018827 Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence 244126-244165 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP012461 Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence 192112-192151 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023795 Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_MG674581 Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP023781 Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence 453-492 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LT598664 Enterococcus faecium isolate Ef_aus00233 plasmid 2 168262-168301 0 1.0
LR135186_1 1.2|516|19|LR135186|CRISPRCasFinder 516-534 19 NZ_LR135180 Enterococcus faecium isolate E0595 plasmid 2 516-534 0 1.0
LR135186_1 1.2|516|19|LR135186|CRISPRCasFinder 516-534 19 NZ_LR132068 Enterococcus faecium isolate E0139 plasmid 2 516-534 0 1.0
LR135186_1 1.2|516|19|LR135186|CRISPRCasFinder 516-534 19 NZ_CP037956 Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence 35228-35246 0 1.0
LR135186_1 1.2|516|19|LR135186|CRISPRCasFinder 516-534 19 LR135186 Enterococcus faecium isolate E4413 genome assembly, plasmid: 2 516-534 0 1.0
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP027401 Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence 109447-109486 1 0.975
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR135175 Enterococcus faecium isolate E4402 plasmid 2 453-492 1 0.975
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_LR134096 Enterococcus faecium isolate E1334 plasmid 2 453-492 1 0.975
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP042833 Enterococcus faecium strain FA3 plasmid unnamed1 47628-47667 1 0.975
LR135186_1 1.1|453|40|LR135186|CRISPRCasFinder 453-492 40 NZ_CP012367 Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence 3358-3397 5 0.875

1. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

2. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

3. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

4. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

5. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

6. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

7. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

8. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

9. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

10. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

11. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

12. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

13. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

14. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

15. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

16. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

17. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

18. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

19. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

20. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

21. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

22. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

23. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

24. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

25. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

26. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

27. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

28. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

29. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

30. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

31. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

32. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

33. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

34. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

35. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

36. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

37. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

38. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

39. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

40. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

41. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

42. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

43. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

44. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

45. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

46. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

47. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

48. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

49. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

50. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

51. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

52. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

53. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

54. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

55. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

56. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

57. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

58. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

59. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

60. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

61. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

62. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

63. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

64. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

65. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

66. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

67. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

68. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

69. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

70. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

71. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

72. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

73. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

74. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

75. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

76. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

77. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

78. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

79. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

80. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

81. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

82. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

83. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

84. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

85. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

86. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

87. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

88. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

89. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

90. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

91. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

92. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

93. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

94. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

95. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

96. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

97. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

98. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

99. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

100. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

101. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

102. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

103. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

104. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

105. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

106. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

107. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

108. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

109. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

110. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

111. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

112. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

113. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

114. spacer 1.2|516|19|LR135186|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

tttccaaaacgttgataaa	CRISPR spacer
tttccaaaacgttgataaa	Protospacer
*******************

115. spacer 1.2|516|19|LR135186|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

tttccaaaacgttgataaa	CRISPR spacer
tttccaaaacgttgataaa	Protospacer
*******************

116. spacer 1.2|516|19|LR135186|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

tttccaaaacgttgataaa	CRISPR spacer
tttccaaaacgttgataaa	Protospacer
*******************

117. spacer 1.2|516|19|LR135186|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

tttccaaaacgttgataaa	CRISPR spacer
tttccaaaacgttgataaa	Protospacer
*******************

118. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

119. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

120. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

121. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
**.*************************************

122. spacer 1.1|453|40|LR135186|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.875

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggctc	Protospacer
*******************************.* *** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage